Zero-background cloning vector as well as preparation method and application thereof

A cloning vector, zero background technology, applied in the field of bioengineering, can solve problems such as gene inability to express, plasmid interference, and vector quality influence

Active Publication Date: 2015-01-28
TIANGEN BIOTECH BEIJING
View PDF3 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, when a toxic gene is used to construct a vector, in order to multiply the plasmid vector, blocking sequences are generally used to destroy the reading frame of the toxic gene so that the gene cannot be expressed, which may lead to the interference of a small amount of undigested plasmid and affect the vector. quality has some influence

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Zero-background cloning vector as well as preparation method and application thereof
  • Zero-background cloning vector as well as preparation method and application thereof
  • Zero-background cloning vector as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1 0

[0086] Example 1 Preparation of zero background cloning vector

[0087] To prepare a zero-background cloning vector, it is first necessary to construct a pre-vector of a zero-background cloning vector, and the inventors selected a high-copy pUC19 plasmid for transformation. Proceed as follows:

[0088] (1) Artificially synthesize a gene sequence shown in SEQ ID NO: 6, which includes the ribonuclease gene driven by the LacUV5 promoter (SEQ ID NO: 4), the spacer sequence of the ccdB gene (SEQ ID NO: 5), and Multiple cloning site (SEQ ID NO:3). Synthetic primers are as follows:

[0089]

[0090]

[0091] (2) Dilute all the primers in (1) above to a concentration of 50 micromole / liter with sterile water, draw 5 microliters of each primer and add it to a PCR tube to form a primer mixture, and then use Fast HiFidelity PCR Kit (Tiangen Biochemical Technology (Beijing) Co., Ltd., article number: KP202), using fast high-fidelity polymerase for the first round of amplification ...

Embodiment 2

[0115] Embodiment 2 uses the implementation method of the connection gene fragment of zero background cloning vector

[0116] 1. Obtaining the target gene fragment

[0117] Using lambda phage DNA as a template, design primers as follows:

[0118] The forward primer of the 700-base gene fragment (hereinafter referred to as 700-F): GAGGGCAAGTATCGTTTCCA (SEQ ID NO: 70)

[0119] The reverse primer of the 700-base gene fragment (hereinafter referred to as 700-R): ACTGGAAAGCAACGAAGTCC (SEQ ID NO: 71)

[0120] The forward primer of the 2000-base gene fragment (hereinafter referred to as 2K-F): ATCTGCCTTTACGGGGATTT (SEQ ID NO: 72)

[0121] The reverse primer of the 2000-base gene fragment (hereinafter referred to as 2K-R): GTACAGCCAAAGGCATCCAT (SEQ ID NO: 73)

[0122] The forward primer of the 8000-base gene fragment (hereinafter referred to as 8K-F): ATCCCATGTCGGCAAGCATAAGC (SEQ ID NO: 74)

[0123] The reverse primer of the 8000-base gene fragment (hereinafter referred to as 8K-R...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for preparing a zero-background cloning vector, and application of the zero-background cloning vector. The method for preparing the zero-background cloning vector comprises the following steps: providing a DNA segment as shown in the sequence SEQ ID NO:6; performing first PCR amplification by taking pUC19 plasmid as a template and utilizing primers as shown in the sequences SEQ ID NO:7-8, thereby obtaining a pUC19 vector segment; performing homologous recombination on the DNA segment and the pUC19 vector segment, thereby obtaining a vector framework; converting the vector framework into competent cells, and extracting the plasmid, thereby obtaining a previous vector of the zero-background cloning vector; and performing enzyme digestion on the previous vector of the zero-background cloning vector by using EcoRV enzyme, thereby obtaining the zero-background cloning vector. The vector obtained by using the method can be directly used for connecting flat tail end products, the vector self-connection background is low, the positive rate of cloning is high, blue and white screening is not needed, rapid and effective cloning can be achieved within a short time, the cloning efficiency is high, and the effect is good.

Description

technical field [0001] The present invention relates to the technical field of bioengineering, in particular, to a zero-background cloning vector and its preparation method and application, and more specifically, the present invention relates to a method for preparing a zero-background cloning vector, a zero-background cloning vector and its use in preparing a target gene cloning vector The use in and the method for preparing the target gene cloning vector. Background technique [0002] Genetic engineering at this stage involves a large number of gene cloning techniques, inserting gene fragments into cloning vectors to facilitate long-term preservation of genes and downstream molecular biology operations. Common cloning vectors on the market, such as those with thymine T protruding ends (hereinafter referred to as T vectors), mostly use the β-galactosidase gene for blue-white screening. The disadvantage is that the proportion of blue-white spots is high, and there are also w...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/63C12N15/66
Inventor邹爱兰俞萍李晓晨孙克非
OwnerTIANGEN BIOTECH BEIJING