Check patentability & draft patents in minutes with Patsnap Eureka AI!

Universal detection primer and DNA barcode molecular identification method for bursaphelenchus xylophilus and similar species thereof

A general-purpose detection technology for pine wood nematode, applied in the direction of recombinant DNA technology, biochemical equipment and methods, DNA/RNA fragments, etc., can solve the problems of small application range, inability to adapt to identification experience, and inability to identify similar species of pine wood nematode , to achieve the effect of accurate identification and wide application value

Inactive Publication Date: 2015-03-25
NINGBO ACAD OF SCI & TECH FOR INSPECTION & QUARANTINE
View PDF3 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

With the continuous development of human cognition, similar species of B. xylophilus have been discovered continuously. The previous morphological and classical molecular biology methods on B. xylophilus and its related species are no longer applicable due to their small scope of application and the need for rich identification experience. Adapt to identification needs
The invention patent application with the publication number CN101586160 discloses specific detection primers for pine xylophilus, but it can only carry out DNA molecular identification of pine xylophilus, and cannot identify other known similar species of pine xylophilus

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0011] Below in conjunction with embodiment the present invention is described in further detail.

[0012] 1. Separation of nematodes from wood or wood packaging: Saw pine wood or wood packaging samples (samples 1 to 6, respectively) into wood sections with a length of about 5-10 cm, and split them into wood chips with a width of about 0.5 cm. Clean the chopping boards, saws, axes, etc. after the sample preparation of each batch of samples to prevent mutual infection of different batches of wooden packaging. Put the prepared wood chips into the improved nematode separator, add appropriate amount of water to submerge the water surface of the wood chips (if the wood chips have a lot of impurities, they can be washed with water and then soaked; if the wood chips are obviously floating, they can be pressed with a heavy object). Stand at about 25°C for 24 hours, so that the nematodes free wood chips and gradually sink to the bottom of the funnel. Then use a concave dish to pick up...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a universal detection primer and a DNA barcode molecular identification method for bursaphelenchus xylophilus and similar species thereof. A forward primer is represented as AGTACCGTGAGGGAAAGTTGA and a reverse primer is represented as GCTACTAGATGGTTCGATTAGTCT; the universal primer can be used for amplifying for D2 / D3 in a ribosomal 28S gene of the bursaphelenchus xylophilus, sequencing an amplified product, comparing the detected sequence with an established sequence standard database of the bursaphelenchus xylophilus and similar species thereof, and rapidly and accurately identifying the bursaphelenchus xylophilus and similar species thereof depending on the differences of DNA sequence of the 28S; and the universal detection primer and the DNA barcode molecular identification method have extensive using value in such aspects as exit and entry plant quarantine, domestic forestry quarantine and forest nematode disease investigation.

Description

technical field [0001] The invention relates to the identification of pine wood nematode and its similar species, in particular to a general detection primer and a DNA barcode molecular identification method of the pine wood nematode and its similar species. Background technique [0002] Pine xylophilus B. xylophilus (Steiner & Buhrer, 1934) Nickle, 1970 is the most destructive pest of pine forests worldwide. The nematode originated in North America and was introduced to Japan in the early 20th century by importing a large number of pine products from the United States, causing the death of a large number of pine trees in Japan. Since then, the nematode was introduced into my country in 1982, South Korea in 1988, Portugal in 1999, and Spain in 2011, all of which caused great harm and attracted great attention from all over the world. Before 2000, there were only three known species of B. xylophilus and its related species, namely B. xylophilus, B. xylophilus and Pseudomon...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6888C12Q2600/156
Inventor 顾建锋何洁陈先锋
Owner NINGBO ACAD OF SCI & TECH FOR INSPECTION & QUARANTINE
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More