SgRNA (small guide ribonucleic acid) pair for specifically identifying porcine H11 locus, and coding DNA (deoxyribonucleic acid) and application thereof

A technology for specific identification and DNA molecule application in sgRNA and its coding DNA and application fields, to achieve the effect of reducing off-target phenomenon, strong specificity and increasing efficiency

Active Publication Date: 2015-04-29
INST OF ANIMAL SCI OF CHINESE ACAD OF AGRI SCI
View PDF2 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Experiments confirm that there is no difference in growth and development between Hipp11-site-directed gene-modified mice and wild-type mice

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • SgRNA (small guide ribonucleic acid) pair for specifically identifying porcine H11 locus, and coding DNA (deoxyribonucleic acid) and application thereof
  • SgRNA (small guide ribonucleic acid) pair for specifically identifying porcine H11 locus, and coding DNA (deoxyribonucleic acid) and application thereof
  • SgRNA (small guide ribonucleic acid) pair for specifically identifying porcine H11 locus, and coding DNA (deoxyribonucleic acid) and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Example 1 Construction of sgRNA expression plasmid pair

[0025] 1. sgRNA target design

[0026] According to the H11 site of the mouse, find the Eif4 and Drg genes of the pig (the site of the mouse is located in the middle of the two genes), call out the middle region in NCBI to find the H11 site of the pig, and its nucleotide sequence is shown in the sequence table As shown in sequence 5 in,

[0027] Select the sgRNA target for gene knockout according to the PAM sequence, the PAM sequence is NGG:

[0028] sgRNA-L target site position 1 (named H11-sgL2):

[0029] AGATCAGGGTGGGCAGCTCTGGG

[0030] The nucleotide sequence for recognizing the target in the corresponding sgRNA-L sequence is shown in sequence 1 in the sequence listing; the DNA sequence encoding the above sequence is shown in sequence 3 in the sequence listing.

[0031] sgRNA-R target site position 2 (named H11-sgR1): TTCCAGGAACATAAGAAAGTAGG, the corresponding sgRNA sequence recognizes the target nucleoti...

Embodiment 2

[0041] Example 2 Efficiency verification of sgRNA expression plasmid pair

[0042] 1. Isolation of porcine fetal fibroblasts.

[0043] PEF cells were isolated from aborted pig fetuses. For specific operations, please refer to the literature: Li Hong, Wei Hongjiang, Xu Chengsheng, Wang Xia, Qing Yubo, Zeng Yangzhi; The establishment and biological academic features.

[0044] 2. Nucleofection

[0045] 2 μg each of the recombinant plasmids pX335-sgRNA-H11-L and pX335-sgRNA-H11-R were co-transfected into PEF cells by electroporation to obtain recombinant cells. The specific steps of transfection are as follows: use a nuclear transfer instrument (Amaxa, model: AAD-1001S) and a matching mammalian fibroblast transfection kit (Amaxa, product number: VPI-1002) for transfection. First, use 0.1% trypsin (Gibco, catalog number: 610-5300AG) to digest adherent cells, stop digestion with fetal bovine serum (Gibco, catalog number: 16000-044), and wash with phosphate buffer saline (Gibco, c...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an sgRNA (small guide ribonucleic acid) pair for specifically identifying porcine H11 locus, and a coding DNA (deoxyribonucleic acid) and application thereof. The sgRNA pair is composed of sgRNA-F and sgRNA-R, wherein the nucleotide sequence of the sgRNA-L is 1) or 2): 1) nucleotide sequence disclosed as Sequence 1 in the sequence table, and 2) nucleotide sequence with the same functions as the nucleotide sequence disclosed as 1) subjected to substitution and / or deletion and / or addition of one or more bases on the nucleotide sequence disclosed as 1); and the nucleotide sequence of the sgRNA-R is 3) or 4): 3) nucleotide sequence disclosed as Sequence 2 in the sequence table, and 4) nucleotide sequence with the same functions as the nucleotide sequence disclosed as 3) subjected to substitution and / or deletion and / or addition of one or more bases on the nucleotide sequence disclosed as 3). The sgRNA pair can greatly increase the fixed point insertion efficiency of the exogenous gene, and provides a stable platform for preparation of transgenic pigs.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to two sgRNAs specifically recognizing pig H11 sites, their coding DNA and applications. Background technique [0002] In 2010, Simon Hippenmeyer of Stanford University and his research team isolated and identified a good gene insertion site on chromosome 11 of the mouse, named hipp11 site, or H11 site for short. The H11 site is located in the gap between the two genes Eif4enif1 and Drg1, adjacent to exon 19 of the Eif4enif1 gene and exon 9 of the Drg1 gene, with a size of about 5 kb. Because the H11 site is located between the two genes, it is relatively safe, has no gene silencing effect, and has a broad spectrum of cell expression activity. Experiments confirmed that the Hipp11 locus site-specific gene-modified mice had no difference in growth and development from wild-type mice. At present, there is a similar Ros26 site, but this site is a gene whose pr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/113C12N15/11C40B40/08
Inventor杨述林阮进学李奎李和刚牟玉莲吴添文魏景亮徐奎黄雷周荣刘楠
OwnerINST OF ANIMAL SCI OF CHINESE ACAD OF AGRI SCI