A method of silencing the ifnar1 gene in the df‑1 cell line
A GV248-IFNAR1, cell line technology, applied in DNA/RNA fragments, recombinant DNA technology, genetic engineering, etc., can solve the problems of high production cost and insufficient vaccine antigen quality, and achieves high production cost and antigen quality. Insufficient, the effect of reducing production costs
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0032] 1. Screening of siRNA that interferes with IFNAR1 gene transcription
[0033] 1. Design and synthesis of oligonucleotide sequence of shRNA that interferes with IFNAR1 gene
[0034] According to the IFNAR1 gene sequence registered in Genbank and the addgene lentiviral vector construction program, siRNAs with 3 RNA interference target sequences were designed at http: / / jura.wi.mit.edu / bioc / siRNAext / (such as figure 1 shown), and set up the control group Scramble at the same time, the sequence is as follows: sh1: 5′-AAATGTGGCTAATTTCTGTGT-3′ (SEQ No.1); sh2: 5′-TA CGACGATAATACCTCCAA-3′ (SEQ No.2); sh3: 5′- TAGGATCACAGAAGAAGTAAA-3'(SEQ No.3); Scramble: CCTAAGGTTAAGTCGCCCTCG(SEQ No.4). According to the characteristics of the pLKO.1-TRC cloning vector, the DNA sequence of the siRNA and its corresponding complementary sequence were connected with a loop sequence to form a sense strand and a reverse The sense strand is introduced into the adapter sequence at both ends, and shRNA...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



