Unlock instant, AI-driven research and patent intelligence for your innovation.

A method of silencing the ifnar1 gene in the df‑1 cell line

A GV248-IFNAR1, cell line technology, applied in DNA/RNA fragments, recombinant DNA technology, genetic engineering, etc., can solve the problems of high production cost and insufficient vaccine antigen quality, and achieves high production cost and antigen quality. Insufficient, the effect of reducing production costs

Active Publication Date: 2018-04-17
POULTRY INST SHANDONG ACADEMY OF AGRI SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The purpose of the present invention is to overcome the deficiencies existing in the production of existing avian influenza vaccines, to provide a method for silencing the IFNAR1 gene in the DF-1 cell line, which can increase the antigen content of the avian influenza virus in the DF-1 cell line to 5- 10 times, not only can solve the problem of insufficient vaccine antigen and high production cost, but also promote the research and development of bird flu bioreactor cell culture technology

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method of silencing the ifnar1 gene in the df‑1 cell line
  • A method of silencing the ifnar1 gene in the df‑1 cell line
  • A method of silencing the ifnar1 gene in the df‑1 cell line

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0032] 1. Screening of siRNA that interferes with IFNAR1 gene transcription

[0033] 1. Design and synthesis of oligonucleotide sequence of shRNA that interferes with IFNAR1 gene

[0034] According to the IFNAR1 gene sequence registered in Genbank and the addgene lentiviral vector construction program, siRNAs with 3 RNA interference target sequences were designed at http: / / jura.wi.mit.edu / bioc / siRNAext / (such as figure 1 shown), and set up the control group Scramble at the same time, the sequence is as follows: sh1: 5′-AAATGTGGCTAATTTCTGTGT-3′ (SEQ No.1); sh2: 5′-TA CGACGATAATACCTCCAA-3′ (SEQ No.2); sh3: 5′- TAGGATCACAGAAGAAGTAAA-3'(SEQ No.3); Scramble: CCTAAGGTTAAGTCGCCCTCG(SEQ No.4). According to the characteristics of the pLKO.1-TRC cloning vector, the DNA sequence of the siRNA and its corresponding complementary sequence were connected with a loop sequence to form a sense strand and a reverse The sense strand is introduced into the adapter sequence at both ends, and shRNA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for silencing IFNAR1 gene in DF‑1 cell line. It first designs multiple siRNAs of RNA interference target sequences based on the IFNAR1 gene, and further screens out siRNAs that knock down the expression of the IFNAR1 gene at the mRNA level; then constructs a lentiviral vector containing the IFNAR1 RNAi gene; The gene is mediated into the DF-1 cell line, the expression of the IFNAR1 gene is silenced, and the proliferation titer of the avian influenza virus in the DF-1 cell line is increased. This method can increase the antigen content of the avian influenza virus in the DF-1 cell line by 5-10 times, greatly reducing the production cost of the vaccine, not only solving the problems of insufficient vaccine antigen content and high production costs, but also promoting the biological response of avian influenza The research and development process of organoid cell culture technology.

Description

technical field [0001] The invention relates to a method for silencing an interferon receptor 1 (Interferon receptor 1, IFNAR1) gene in a DF-1 cell line, which is used for increasing the proliferation titer of avian influenza virus in the cell line, and belongs to the field of biotechnology. Background technique [0002] With the rapid development of intensive breeding industry, important poultry diseases such as avian influenza are becoming the focus of public health security, and controlling diseases from the source is the top priority of the current prevention and control strategy. Practice has proved that vaccine immunization and rapid detection are the most effective measures to prevent and control major animal diseases. Due to the low titer of avian influenza virus cell culture, poultry embryos are still mainly used to produce vaccines in China at present, which has low efficiency, high energy consumption, and the possibility of foreign virus contamination. my country...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/867C12N15/113C12N15/12
Inventor 李玉峰亓丽红马秀丽刘存霞刘爱玲黄兵刘华雷宋敏训朱建华王绛辉
Owner POULTRY INST SHANDONG ACADEMY OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More