Small molecule inhibitor and application thereof to inhibiting ornithine decarboxylase (ODC)
A small molecule inhibitor, ornithine decarboxylase technology, applied in the field of biomedicine, can solve the problems of high toxicity and side effects, high concentration, and weak binding ability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0043] The small molecule inhibitors involved are:
[0044] 2-[(hydroxyimino)methyl]-1-[2-(4-methoxyphenyl)-2-oxoethyl]pyridinium, the structural formula is shown in the formula.
[0045]
[0046] The activity detection method is as follows:
[0047] 1. Construction of human ODC prokaryotic expression plasmid
[0048] The gene sequence of human ODC was inserted into the pET28a plasmid through BamH I and Xho I restriction sites to construct the pET28a-hODC plasmid, which was verified by DNA sequencing.
[0049] Gene sequence of human ODC:
[0050] atgaacaactttggtaatgaagagtttgactgccacttcctcgatgaaggttttactgccaaggacattctggaccagaaaattaatgaagtttcttcttctgatgataaggatgccttctatgtggcagacctgggagacattctaaagaaacatctgaggtggttaaaagctctccctcgtgtcacccccttttatgcagtcaaatgtaatgatagcaaagccatcgtgaagacccttgctgctaccgggacaggatttgactgtgctagcaagactgaaatacagttggtgcagagtctgggggtgcctccagagaggattatctatgcaaatccttgtaaacaagtatctcaaattaagtatgctgctaataatggagtccagatgatgacttttgatagtgaagttgagttgatgaaagttgccagag...
Embodiment 2
[0071] The small molecule inhibitors involved are:
[0072] 2-(1-Hydroxyimino-ethyl)-1-[2-(3-methoxymethyl-phenyl)-2-oxo-ethyl]-pyridinium,
[0073] The structural formula is as shown in the formula:
[0074]
Embodiment 3
[0076] The small molecule inhibitors involved are:
[0077] 3-(2-Hydroxyimino-ethylideneaminooxy)-1-[2-(2-methoxymethyl-phenyl)-2-oxo-ethyl]-pyridinium,
[0078] The structural formula is as shown in the formula:
[0079]
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap