Multiple-exchange unmarked site-specific integration transgenic system and application thereof
A transgenic and integrase technology, applied in the field of bioengineering, can solve the problems of long production cycle, high cost, and animal transgenic technology needs to be improved, and achieve the effect of short production cycle
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0075] Example 1 Construction and activity detection of TALEN vector (first construct) for identifying pR26 site
[0076] The pR26 site sequence was analyzed, and SEQ ID NO: 1 was selected as the TALEN vector recognition splicing sequence. Among them, TALEN1 recognizes TGCCGTAATGCTAATAGC (SEQ ID NO:4), that is, the assembled TALEN1 module sequence is NN-HD-HD-NN-NG-NI-NI-NN-HD-NG-NI-NI-NG-NI-NN-HD .
[0077] TALEN2 recognizes the reverse complementary sequence of CTGTCTCCAGTATCTGA (SEQ ID NO:5), and the sequence of modules for assembling TALEN2 is HD-NI-NN-NI-NG-NI-HD-NG-NN-NN-NI-NN-NI HD-NI -NN.
[0078]The TALEN expression backbone vector of this example was transformed according to the following steps: amplify the CMV-MCS-BGPA sequence on the commercial vector pcDNA3.1(-) and connect it to the T vector to construct CMV-T. Synthesize the TALE-fokI sequence, in which the TALE protein synthesizes 456 nucleotides in the N segment (translation of 152 amino acid residues), 189...
Embodiment 2
[0087] Example 2 pR26 Targeting Vector (Second Construct) Construction
[0088] Design left and right homology arm amplification primers to amplify the homology arms. And the upstream primer of the left homology arm introduces the SalI restriction site, and the downstream primer of the left homology arm introduces the loxp sequence and the NheI and HindIII restriction sites; the upstream primer of the right homology arm introduces the lox2272 sequence and the NotI restriction enzyme site, the downstream primer of the right homology arm introduces the NheI restriction site, and the primer sequence is as follows:
[0089] pR26LA-F: GTC GAC GTCAGTTTGCTCCTTCTCG (SEQ ID NO: 10)
[0090] SalI
[0091] pR26LA-R: GCTAGC AAG AAGCTT ATAACTTCGTATAGCATACATTATACGAAGTTAT
[0092] NheI HindIII loxp
[0093] GACACTAGTTTGGAAGCTA (SEQ ID NO: 11)
[0094] pR26RA-F:
[0095] GCGGCCGC ATAACTTCGTATAAGGTATCCTATACGAAGTTAT TCTGTCTCCAGTATC
[0096] NotI lox227...
Embodiment 3
[0117] Example 3 Transfection Screening and Identification of pR26 Targeted Cells
[0118]Extract endotoxin-free TALENs plasmid and pR26 targeting vector plasmid. The pR26 targeting vector was digested with SalI to linearize it. The TALENs plasmid and the pR26 linearized fragment were co-transfected into Bama pig fetal fibroblasts by nuclear transfer method, and the transfection ratio was 2 μg TALENs: 0.4 μg pR26 targeting vector.
[0119] Divide the transfected cells to 10cm, and use 500μg / ml G418 to screen the cells. After 1 week of screening, positive clones appear, pick the positive clones to a 48-well plate and continue to expand the culture, and change the concentration of 200μg / ml G418 maintain. It should be noted that the lethal concentration of G418 is different for different cell lines, so the lethal concentration of G418 must be measured for the cell lines first. The lethal concentration of G418 for the Bama fibroblast cell line in this example is 500 μg / ml.
[0...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
