cDNA full-length sequence of zebrafish tmem132e gene and application thereof
A gene sequence, zebrafish technology, applied in the field of genetic engineering
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0052] Embodiment 1: the cloning of zebrafish tmem132e gene sequence:
[0053] (1) Extract total RNA from zebrafish larvae;
[0054] Take the wild-type zebrafish of Tu line 3 days after fertilization, grind it with a grinding rod in a 1.5ml Ep tube, and then use the Trizol kit from Takara Company to extract the total RNA according to the kit instructions.
[0055] (2) Primer design
[0056] Firstly, the mRNA sequences of zebrafish tmem132e were downloaded from NCBI Genbank, XM_003198707 and XM_68740, respectively. After BLAST alignment, the consensus sequences of the two were analyzed, and Primer 5 software was used to design primers. Because the gene is relatively large, two pairs of primers were designed to amplify the 5' end and 3' end of the zebrafish tmem132e gene cDNA respectively. In order to facilitate full-length splicing, the designed primers should ensure that the amplified two DNA fragments have partial sequence overlap. The primer sequence for amplifying the 5' ...
Embodiment 2
[0074] Example 2: Application of the zebrafish tmem132e gene sequence in the preparation of marlin generation oligonucleotides
[0075] The genome structure of zebrafish tmem132e was obtained through Example 1, the sequence of each exon and intron was clarified, and effective marin generation oligonucleotides were designed to reduce the expression of tmem132e gene in zebrafish and establish tmem132e gene defect disease zebrafish model, so as to study the pathogenesis of deafness caused by tmem132e gene mutation, as well as the development of drugs for the treatment of deafness.
[0076] After comparison, the tmem132e gene has 10 exons, and the intron2 / exon3 linker sequence is as follows:
[0077] attgttttgctctgtctaacatccaaaagagtccaggacaacaattctgagtgagtgcaa
[0078] atttgagaatgcctaacccactatgacctatcaattgttttctcagAACGGCCAGAGACA
[0079] GTGATGACGACGATGACGATGACCGCAAAGTGAGCCGGGGATGTACACTCCAGTACCAGA
[0080] GGGCCCAGATTAAGGTTTTGACCCAGTCCACACAACTTCATCTGAAGGCACAAATCAGA
[0081] No...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
