Unlock instant, AI-driven research and patent intelligence for your innovation.

cDNA full-length sequence of zebrafish tmem132e gene and application thereof

A gene sequence, zebrafish technology, applied in the field of genetic engineering

Inactive Publication Date: 2015-08-05
SHANDONG UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Among them, the XM_003198707 sequence is a partial mRNA sequence of the tmem132e gene, which is only 1451bp; the full length of XM_68740 is 2615bp. These two sequences are the mRNA sequence of the zebrafish tmem132e gene predicted by computer software analysis based on the zebrafish genome sequencing results , has not been verified in the laboratory

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • cDNA full-length sequence of zebrafish tmem132e gene and application thereof
  • cDNA full-length sequence of zebrafish tmem132e gene and application thereof
  • cDNA full-length sequence of zebrafish tmem132e gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] Embodiment 1: the cloning of zebrafish tmem132e gene sequence:

[0053] (1) Extract total RNA from zebrafish larvae;

[0054] Take the wild-type zebrafish of Tu line 3 days after fertilization, grind it with a grinding rod in a 1.5ml Ep tube, and then use the Trizol kit from Takara Company to extract the total RNA according to the kit instructions.

[0055] (2) Primer design

[0056] Firstly, the mRNA sequences of zebrafish tmem132e were downloaded from NCBI Genbank, XM_003198707 and XM_68740, respectively. After BLAST alignment, the consensus sequences of the two were analyzed, and Primer 5 software was used to design primers. Because the gene is relatively large, two pairs of primers were designed to amplify the 5' end and 3' end of the zebrafish tmem132e gene cDNA respectively. In order to facilitate full-length splicing, the designed primers should ensure that the amplified two DNA fragments have partial sequence overlap. The primer sequence for amplifying the 5' ...

Embodiment 2

[0074] Example 2: Application of the zebrafish tmem132e gene sequence in the preparation of marlin generation oligonucleotides

[0075] The genome structure of zebrafish tmem132e was obtained through Example 1, the sequence of each exon and intron was clarified, and effective marin generation oligonucleotides were designed to reduce the expression of tmem132e gene in zebrafish and establish tmem132e gene defect disease zebrafish model, so as to study the pathogenesis of deafness caused by tmem132e gene mutation, as well as the development of drugs for the treatment of deafness.

[0076] After comparison, the tmem132e gene has 10 exons, and the intron2 / exon3 linker sequence is as follows:

[0077] attgttttgctctgtctaacatccaaaagagtccaggacaacaattctgagtgagtgcaa

[0078] atttgagaatgcctaacccactatgacctatcaattgttttctcagAACGGCCAGAGACA

[0079] GTGATGACGACGATGACGATGACCGCAAAGTGAGCCGGGGATGTACACTCCAGTACCAGA

[0080] GGGCCCAGATTAAGGTTTTGACCCAGTCCACACAACTTCATCTGAAGGCACAAATCAGA

[0081] No...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Belonging to the technical field of genetic engineering, the invention specifically relates to the cDNA full-length sequence of zebrafish tmem132e gene and application thereof. The invention provides the full-length sequence of zebrafish tmem132e gene, the DNA full length is 3222bp, the cDNA full-length sequence contains 3219bp open reading frame, and the nucleotide sequence is shown as SEQ ID NO.1. The invention also provides a zebrafish tmem132e gene encoded protein molecule. With the zebrafish tmem132e gene provided by the invention, purified protein or oligonucleotide with bioactivity can be artificially synthesized according to the gene sequence or can be obtained by genetically modified biosynthesis, thus being conducive to understanding the genomic structure of the zebrafish tmem132e gene and analyzing the gene expression and protein functions.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to the full-length expression sequence of the zebrafish tmem132e gene and a protein encoded by it, as well as the cloning and detection methods of the gene. Background technique [0002] Most life processes are highly conserved in the long-term evolutionary process, and model organisms have therefore become important tools for studying human development, system function, disease occurrence, etc. In particular, the embryonic development process of vertebrates and humans is quite similar in shape , the signaling pathways and genes involved at the cellular and molecular levels generally also have a high degree of homology. As a new type of vertebrate model organism, zebrafish has many advantages such as strong reproductive ability, in vitro fertilization and development, transparent embryo, short sexual maturity cycle, small individual and easy breeding, etc. In...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/12C07K14/46C12N15/11C12N15/10C12N15/113
Inventor 李江夏刘奇迹龚瑶琴
Owner SHANDONG UNIV