Species-specific polymerase chain reaction (SS-PCR) specific primers and kit for fast identification of Bactrocera rubigina

Abstract

The invention belongs to the field of quarantine insect detection and relates to species-specific polymerase chain reaction (SS-PCR) specific primers and a kit for fast identification of Bactrocera rubigina. The SS-PCR specific primer pair comprises XF29: 5'GTAGGAACTTCGCTTAGAATTTTAG3' and XR293: 5'GACTTCTTACTAATAGAAGCGTGA3'. The method for fast identification of Bactrocera rubigina by SS-PCR has the advantages of simple processes, high specificity and high sensitivity, can realize identification of Bactrocera rubigina in 8h and can satisfy port fast inspection and quarantine requirements.

Description

technical field [0001] The invention belongs to the field of quarantine pest detection, and in particular relates to SS-PCR specific primers and a kit for rapidly identifying Bactrocera rustia. Background technique [0002] Rust fly Bactrocera (Bactrocera) rubigina (Wang&Zhao) is a major invasive quarantine pest, belonging to Diptera Diptera Tephritidae Tephritidae Bactrocera genus Bactrocera Bactrocera subgenus Bactrocera. Rust fruit fly is an important agricultural pest. It was first intercepted at Luohu Port in 1999 in my country. Now it is mainly distributed in Laos, Bhutan, Bangladesh, and Hainan, Guangzhou, Guangxi, Yunnan and other places in China. The larvae, eggs or pupae of various fruit flies are often intercepted in the fruits and vegetables entering and leaving the country, and even the head, chest, wings, feet and other residues are often intercepted. The classification and identification of larvae is much more difficult than that of adults. In order to ensure ...

AI Technical Summary

Problems solved by technology

Although the prior art provides software for designing amplification primers based on known sequences, it cannot solve the problem of how to have both sensitivity and specificity

Images