Supercharge Your Innovation With Domain-Expert AI Agents!

Compound porcine alpha interferon gene and synthetic method thereof

A technology of alpha interferon and synthesis method, applied in the field of genetic engineering, can solve the problems of few sources, high price, complicated purification process, etc., and achieve the effect of reducing toxicity and good antiviral activity

Inactive Publication Date: 2015-09-02
JIANGSU HFQ BIO TECH CO LTD
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The natural porcine IFN-α induced by inducers is expensive due to many reasons such as few sources, high cost, and complicated purification process, which greatly limits the clinical and scientific applications. System, so that it can be efficiently expressed, and the production of interferon with the advantages of low cost, broad-spectrum antiviral activity, non-toxicity, and no residue is undoubtedly an effective way to promote the application of interferon in veterinary clinics

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Compound porcine alpha interferon gene and synthetic method thereof
  • Compound porcine alpha interferon gene and synthetic method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0017] Example 1 A Composite Porcine Interferon Alpha Gene and Its Synthetic Method

[0018] 一种复合猪其α干扰素基因,其DNA序列如下所示:tgtgacctgccacagactcattccctggcccatactagagccctgagactgctggcccagatgagaagaatctccccattctcctgtctggaccatagaagagacttcggttccccacatgaagccttcggtggtaaccaggtccagaaggcccaggccatggccctggtccatgaaatgctgcagcagactttccagctgttctccactgaaggttccgccgccgcctgggacgaatccctgctgcatcagttctgtactggtctggaccagcagctgagagacctggaagcctgtgtcatgcaggaagccggtctggaaggtactccactgctggaagaagactccatcctggccgtcagaaagtacttccatagactgactctgtacctgcaggaaaagtcctactccccatgtgcctgggaaatcgtcagagccgaagtcatgagagtcttctcctcctccactaacctgcaggacagactgagaaagaaggaataa。

[0019] The synthetic method of above-mentioned composite porcine alpha interferon gene is carried out according to the following sequence of steps:

[0020] (1) Synthesis of Composite Porcine Interferon-α Gene

[0021] Log in to GeneBank, search for the gene sequence (serial number: ACV42401.1) encoding porcine interferon alpha mature protein, and use SignalP 3.0Se...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a compound porcine alpha interferon gene. Compared with a yeast expressed natural porcine alpha interferon gene, the compound porcine alpha interferon gene has the advantages that the expressed protein of the compound porcine alpha interferon gene is better in antiviral activity, and the function of resisting 100TCID50VSV virus infection on a porcine kidney cell is improved by 50 times. The invention further provides a synthetic method of the compound porcine alpha interferon gene. The synthetic method adopts pichia pastoris X-33 as a template, requires no additional inducer, and is suitable for industrial production. Due to the adoption of pichia pastoris, toxins which are carried by escherichia coli expressed foreign protein and toxic to porcine cells can be avoided, that is, the toxicity is reduced. The synthetic method is suitable for synthesis of the compound porcine alpha interferon gene.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and relates to a gene and a synthesis method thereof, in particular to a compound pig interferon alpha gene and a synthesis method thereof. Background technique [0002] Interferon is mainly produced by animal cells under the action of inducers such as viruses. Many animals, including humans, mammals, birds, fish, etc., can produce interferon. According to the antigenic properties and molecular structure of interferon, it is divided into different types. Interferon (IFN) is divided into type I and type II. Type I interferon gene lacks introns, including 5 types of α, β, δ, ω, and τ. Type II has only one type γ, which contains introns . They have related structures and share the same receptor (primary receptor), which is widely distributed, including monocytes / macrophages, polymorphonuclear leukocytes, B cells, T cells, platelets, epithelial cells, endothelial cells cells and tumor cells. E...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/21C12N15/81
Inventor 符雷郗洪生施腾鑫田柳
Owner JIANGSU HFQ BIO TECH CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More