Supercharge Your Innovation With Domain-Expert AI Agents!

Recombinant oncolytic adenovirus Ad5-P16 with tumor tissue targeting and cancer suppressor gene repairing properties and application thereof

An oncolytic adenovirus, ad5-p16 technology, applied in the field of oncolytic adenovirus, can solve the problems that tumor killing effect cannot completely kill tumor cells, cells are prone to mutation, cancer recurrence, etc., and achieves good tumor inhibition in vivo and in vitro. Effect

Inactive Publication Date: 2015-09-30
TONGJI HOSPITAL ATTACHED TO TONGJI MEDICAL COLLEGE HUAZHONG SCI TECH
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] 2. Tumor cells are drug-resistant and virus-resistant. Due to the rapid growth of tumor cells, the loss of original tissue function, and intracellular mutations, a single tumor killing effect cannot completely kill tumor cells, resulting in cancer recurrence

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant oncolytic adenovirus Ad5-P16 with tumor tissue targeting and cancer suppressor gene repairing properties and application thereof
  • Recombinant oncolytic adenovirus Ad5-P16 with tumor tissue targeting and cancer suppressor gene repairing properties and application thereof
  • Recombinant oncolytic adenovirus Ad5-P16 with tumor tissue targeting and cancer suppressor gene repairing properties and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] Example 1 Construction of recombinant oncolytic adenovirus Ad5-P16 with tumor tissue targeting and tumor suppressor gene repair

[0058] 1) Using pCMV p16INK4A as a template, design upstream and downstream primers PF and PR containing restriction sites and protective bases,

[0059] PF: ctgatatgcatggagccggcggcggggag,

[0060] PR: gccgcggccgctcaatcggggatgtctgagg;

[0061] 2) Obtain the P16CDS sequence by PCR

[0062] The PCR conditions are: pre-denaturation at 95°C for 5 minutes, denaturation at 95°C for 30 seconds, annealing at 58°C for 30 seconds, extension at 72°C for 30 seconds, 34 cycles, and finally extension at 72°C for 10 minutes;

[0063] 3) Ligate the PCR product into a TA vector, select a single clone, and identify a positive clone;

[0064] 4) Then design the upstream primer P1 in front of the E3gp-19K upstream promoter U6 and design the downstream primer P6 behind the stop codon of the E3gp-19K coding region, respectively:

[0065] P1: cggaagcttacgtaccgg...

Embodiment 2

[0085] Example 2 Recombinant oncolytic adenovirus Ad5-P16 infected tumor cells to detect its infection effect and expression

[0086] 1. Add Ad5 and Ad-P16 viruses at a ratio of 1:100 to 2 plates of cultured U251 cells (the titer is 1:100).

[0087] 2. After culturing for 72 hours, collect the lysed protein of the cells, and perform Western blot experiments to detect the expression of Ad5-P16 with the P16 antibody, and the Beta-Actin antibody as an internal reference antibody.

[0088] Such as figure 1 As shown, the human glioma U251 cells infected with the recombinant oncolytic adenovirus Ad5-P16, compared with the adenovirus Ad5 infection, the expression level of the P16 gene was significantly enhanced.

Embodiment 3

[0089] Embodiment 3MTT method detects and compares cell viability

[0090] 1. Inoculate tumor cells from different tissue sources shown in the figure in a 96-well plate at a density of 2000 / 100uL per well.

[0091] 2. Cultivate overnight. After the cells adhere to the wall, each cancer cell is divided into 1 control group and 2 experimental groups. At least 3 replicate wells are set up for each group, and phosphate buffered solution PBS, Ad5, and Ad5 are added to each group. -P16 1uL each.

[0092] 3. After culturing for 72 hours, add 10 uL of 5 mg / mL MTT solution, and after continuing to culture for 4 hours, add 100 uL of 10% SDS-0.1N HCl solution to each well.

[0093]4. After culturing overnight, use a microplate reader to read the absorbance at 570nm, which is the relative cell viability, and set the control group to 100.

[0094] Such as figure 2 As shown, the recombinant oncolytic adenovirus Ad5-P16, on the basis of the killing effect of Ad5 tumor cells, has a furthe...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a recombinant oncolytic adenovirus Ad5-P16 with tumor tissue targeting and cancer suppressor gene repairing properties and application thereof. Oncolytic adenovirus is obtained through gene modification of adenovirus, can only be copied in tumor cells but not normal cells, and therefore, has tumor tissue targeting property. P16 is a cancer suppressor gene, and people discover that mutation and deletion of P16 are closely related with occurrence and development of various cancers. In normal tissues, P16 inhibits a genome from being copied so as to prevent cells from being transformed from the G1 phase to the S phase, and therefore, deletion or mutation of P16 in tumor cells leads to acceleration and out-of-control of the cell cycle and malignant growth of cancer cells. According to the disclosed oncolytic adenovirus Ad5-P16, intrinsic E3gpP16 of adenovirus is replaced with the cancer suppressor gene P16 through introduction of the protease cleavage sites mutation technology, so that the tumor tissue targeting and cancer suppressor gene repairing properties are achieved. In-vitro MTT experiments and mouse intracranial tumor suppression experiments prove that the recombinant oncolytic adenovirus Ad5-P16 has the efficient tumor cell suppressing and killing effects.

Description

technical field [0001] The invention relates to the field of oncolytic adenovirus, in particular to a recombinant oncolytic adenovirus Ad5-P16 with tumor tissue targeting and tumor suppressor gene repairing properties and its application. Background technique [0002] Oncolytic adenovirus can specifically recognize tumor cells and has the ability to self-replicate in tumor cells. It can directly lyse tumors through massive replication, induce tumor cell apoptosis, autophagy, necrosis, and trigger the body's anti-tumor immunity to exert anti-tumor effects, and has received more and more attention in recent years. In 2005, my country's SFDA approved the world's first oncolytic adenovirus H101 for the treatment of patients with nasopharyngeal carcinoma, becoming the world's first approved recombinant oncolytic adenovirus product. At present, more oncolytic adenoviruses or oncolytic adenovirus products carrying anti-cancer genes are undergoing preclinical and clinical trials, i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N7/01C12N15/861A61P35/00
Inventor 熊方园
Owner TONGJI HOSPITAL ATTACHED TO TONGJI MEDICAL COLLEGE HUAZHONG SCI TECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More