Check patentability & draft patents in minutes with Patsnap Eureka AI!

LAMP (loop-mediated isothermal amplification) detection primer group, LAMP detection kit and LAMP detection method for transgenic soybeans MON87769

A technology of MON87769 and transgenic soybean, which is applied in the field of molecular biology, can solve the problems such as the detection method and kit for detecting transgenic soybean MON87769, etc., and achieves the effect of simple operation and strong specificity.

Active Publication Date: 2015-11-11
JILIN ACAD OF AGRI SCI
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no detection method and kit for the detection of genetically modified soybean MON87769 using the LAMP method

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • LAMP (loop-mediated isothermal amplification) detection primer group, LAMP detection kit and LAMP detection method for transgenic soybeans MON87769

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Embodiment 1 kit and detection method thereof.

[0036] Prepare the LAMP detection kit of transgenic soybean MON87769 according to the following formula, and the specification of each kit is 100 reactions:

[0037] (1) Detection primer solution: Synthesize outer primer F3, outer primer B3, inner primer FIP, inner primer BIP, loop primer LF, and loop primer LB, and use sterilized deionized water or ultrapure water to prepare dry primers with a concentration of 100 μmol / L mother solution, then take 5 μL outer primer F3, 5 μL outer primer B3, 40 μL inner primer FIP, 40 μL inner primer BIP, 5 μL loop primer LF, 5 μL loop primer LB, and put them into a new 1.5mL centrifuge tube, Mix well and prepare 100 μL LAMP detection primer solution, where the primer sequences are:

[0038] Outer primer F3: GTAGATTTCCCGGACATGAA (SEQ ID NO: 1);

[0039] Outer primer B3: TCTTGACATTTCTTCAAACAATCA (SEQ ID NO: 2);

[0040]Internal primer FIP: TCGACACTTGTCTTTTTCTTTCTCTTTTTTACAATTGACCATCATAC...

Embodiment 2

[0053] Embodiment 2 The specificity experiment of kit and detection method.

[0054] The specificity of the kit described in Example 1 and its detection method was tested. The test samples included both transgenic soybean samples and some common transgenic corn, rice, cotton, and rapeseed samples. There were 17 kinds in total, respectively:

[0055] (1) Genetically modified soybean MON87701 (1% content);

[0056] (2) Genetically modified soybean MON87705 (1% content);

[0057] (3) Genetically modified soybean MON87708 (1% content);

[0058] (4) Genetically modified soybean MON87769 (1% content);

[0059] (5) Non-GMO soybean negative control;

[0060] (6) Genetically modified soybean mixed sample S1 (contains MON87701, MON87705, MON87708, MON87769, the content of each genetically modified ingredient is 5%);

[0061] (7) Genetically modified soybean mixed sample S2 (contains MON87701, MON87705, MON87708, MON87769, the content of each genetically modified ingredient is 1%); ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an LAMP (loop-mediated isothermal amplification) detection primer group, an LAMP detection kit and an LAMP detection method for transgenic soybeans MON87769. The primer group consists of six specific primers, and the nucleotide sequence of the primer group is as shown in SEQ ID NO:1-6; the detection kit comprises detection primer solution, DNA (deoxyribonucleic acid) polymerase with strand displacement activity, 10 times reaction buffer, dNTPs (deoxyribonucleoside triphosphate solution) and a color developing agent; according to the detection method, amplification is performed on a sample DNA template at 63 to 65 DEG C by adopting the specific primers and the DNA polymerase with the strand displacement activity, and by adopting a method that the color developing agent is added to observe changes in color, whether the sample contains the components of the transgenic soybeans MON87769 or not is judged. The detection method disclosed by the invention does not need special instruments, has the characteristics of being fast and efficient, simple in operation, high in specificity and the like, and is suitable for on-site test.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and relates to a detection method for transgenic plants and products thereof, in particular to a primer set, a kit and a detection method for rapidly detecting transgenic soybean MON87769 using loop-mediated isothermal amplification technology (LAMP). Background technique [0002] In 2014, the global planting area of ​​genetically modified crops reached 181.5 million hectares, an increase of more than 100 times compared with the initial commercialization in 1996. Currently commercially grown transgenic crops mainly include soybeans, corn, cotton, and rapeseed. Among them, transgenic soybeans have the largest planting area in the world, reaching 90.7 million hectares in 2014, accounting for 50% of the total global transgenic crop area. Genetically modified soybean MON87769 is a new quality-improved genetically modified soybean variety developed by Monsanto Corporation of the United State...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6844C12Q1/6895C12Q2600/166C12Q2531/119C12Q2521/101
Inventor 李飞武闫伟夏蔚邵改革龙丽坤李葱葱刘娜董立明邢珍娟张明
Owner JILIN ACAD OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More