Primers, probes and kit for typing qualitative detection of hepatitis B virus (HBV)
A technology for qualitative detection of hepatitis B virus, applied in the direction of microbiological measurement/test, microbiological, microbiological-based methods, etc., can solve the problems of inability to carry out targeted treatment and inability to judge the genotype of HBV virus in patients
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0072] 1. Design of primers and probes
[0073] Specific primers HBV(FX)-B-F, HBV(FX)-B-R and Taqman fluorescent probe HBV(FX)-B-FP were designed for hepatitis B virus type B. The fluorophore labeled at the 5' end of Taqman fluorescent probe JCV-P is 6-FAM, and the quencher group labeled at the 3' end is BHQ1.
[0074] Upstream primer HBV(FX)-B-F: GGGGAACACCCGTGTGTCT (SEQ ID NO: 1);
[0075] Downstream primer HBV(FX)-B-R: GTCCAGAAGAACCAACAAGAAGA (SEQ ID NO: 2);
[0076] Probe HBV(FX)-B-FP: ATTCGCAGTCCCAAATTCTCCAGTCA (SEQ ID NO: 3).
[0077] Specific primers HBV(FX)-C-F, HBV(FX)-C-R and Taqman fluorescent probe HBV(FX)-C-FP were designed for hepatitis B virus type C. The fluorophore labeled at the 5' end of Taqman fluorescent probe JCV-P is 6-FAM, and the quencher group labeled at the 3' end is BHQ1.
[0078] Upstream primer HBV(FX)-C-F: GGGGTTTTTCTTGTTGACAAG (SEQ ID NO: 4);
[0079] Downstream primer HBV(FX)-C-R: GGACAAGAGGTTGGTGAGTGAT (SEQ ID NO: 5);
[0080] Probe HBV(...
Embodiment 2
[0111] Embodiment 2 clinical sample detection
[0112] 1. Using the method of Example 1, 2 cases of hepatitis B virus type B serum samples, 5 cases of hepatitis B virus negative serum samples, 2 cases of hepatitis B virus type C serum samples, and 2 cases of hepatitis B virus type D serum samples Samples, hepatitis B virus type A serum samples, hepatitis C virus (HCV) blood samples, Epstein-Barr virus (EBV) serum samples, human cytomegalovirus (HCMV) serum samples, a total of 15 samples were tested. Test results such as figure 1 Shown:
[0113] Among them, 2 serum samples of hepatitis B virus type B had S-type amplification curves; the remaining samples included 5 serum samples negative for hepatitis B virus, 2 serum samples of hepatitis B virus type C, and 2 samples of hepatitis B virus Type D serum samples and other common clinical pathogens [including hepatitis C virus (HCV), Epstein-Barr virus (EBV), and human cytomegalovirus (HCMV)] were all negative, and there was no ...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com