Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

UGT1A1 combined gene locus fluorescence detection kit for guiding irinotecan chemotherapeutic drug individualized treatment

A gene locus and chemotherapeutic drug technology, which is applied in the field of UGT1A1 combined gene locus fluorescence detection kits, can solve the problems of high occurrence rate and high cost of chip detection, and achieve low price, high-throughput detection, and easy promotion. Effect

Active Publication Date: 2015-12-23
步迅
View PDF3 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the detection cost of the chip method is high, and the open-tube operation has a high rate of false positives. Although the detection sensitivity is relatively high, the requirements for chip detection equipment and instruments have also become a major obstacle to clinical detection, making it difficult to popularize and promote.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • UGT1A1 combined gene locus fluorescence detection kit for guiding irinotecan chemotherapeutic drug individualized treatment
  • UGT1A1 combined gene locus fluorescence detection kit for guiding irinotecan chemotherapeutic drug individualized treatment
  • UGT1A1 combined gene locus fluorescence detection kit for guiding irinotecan chemotherapeutic drug individualized treatment

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0063] The invention provides a method for detecting UGT1A1*28, *6, *93, *60 gene loci.

[0064] 1. The 5' end of the probe used for UGT1A1*28 wild-type detection is labeled with FAM fluorescent dye, and the 5' end of the probe for mutant detection is labeled with JOE fluorescent dye; it is used for UGT1A1*6 (211G>A) The 5' end of the wild-type detection probe of the spot is labeled with FAM fluorescent dye, and the 5' end of the mutant-type detection probe is labeled with JOE fluorescent dye; the probe used for wild-type detection of UGT1A1*60 (-3279T>G) The 5' end of the needle is labeled with FAM fluorescent dye, the 5' end of the probe for mutant detection is labeled with JOE fluorescent dye; the 5' end of the wild-type detection probe for UGT1A1*93 (-3156G>A) site is labeled with FAM fluorescence Dye labeling, the 5' end of the probe for mutant detection is labeled with JOE fluorescent dye, and the 3' end is modified with BHQ1 or BHQ2.

[0065] The 1,700 samples to be te...

Embodiment 2

[0075] Embodiment 2: best primer and probe optimization test:

[0076] The invention designs a series of primers and probes in the research and development stage, and finally screens out a set of primers and probes with the strongest specificity and the best amplification efficiency through PCR conditions and system optimization.

[0077] Comparison of different probes under the same PCR conditions

[0078] probe name probe sequence 20140304P1 5′CACAGTCAAACATTAACTTGGTG 3′ 20140304P2 5′ACACACACAGCAGCAGGC 3′ W28_6*T1 5′cgcaGCCATATATATATAATAAGTAGACtgcg 3′ W28_6*T2 5′CGCGTGATTGGTTTTTGCCATATATATATATAAGTAGACGCG 3′ M28_7*T3 5′cgcagCCATATATATATATATAAGTAGGACtgcg 3′ M28_7*T4 5'CGCGTTGGTTTTTGCCATATATATATATATAAGTAGGACGCG 3' 20140304P3 5′AGTTGTCCTAGCACCTGACG 3′ 20140304P4 5′AAAACATTATGCCCGAGACT 3′ W6*T1 5′ ACGGAGCATTTTACACCTTGAAGAC 3′ M6*T2 5′CAGAGACAGAGCATTTTACACCTTGAA 3′ W6*T3 5′CGCGCGTGTTGTACATCAGAGACGGA...

Embodiment 3

[0087] Embodiment 3: specificity test

[0088] According to Example 1, the method of this kit was compared with the sequencing method for 20 samples, and the matching rate of the results was 100%. The test results are shown in Table 1.

[0089]

[0090]

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a detection kit. The kit adopts UGT1A1*60(-3279T / G), UGT1A1*93(-3156G / A), UGT1A1*28(-536 / 7) and UGT1A1*6(211G / A) four loci as the detection objects, and takes molecular beacon probe fluorescent quantitative PCR as the basis to carry out genotyping detection. The kit provided by the invention can detect four loci at one time, greatly saves cost, and provides a reliable method for clinical diagnosis and scientific research of relevant fields.

Description

technical field [0001] The invention relates to a UGT1A1 combined gene site fluorescence detection kit for guiding individualized treatment of irinotecan chemotherapy drugs, which belongs to the technical field of molecular biology detection. Background technique [0002] In recent years, pharmacogenetics / pharmacogenomics has made breakthroughs in the research on the mechanism of action of chemotherapy drugs, and found that the killing effect of chemotherapy drugs on tumor cells is related to the expression of a specific gene (group) and / or polymorphisms were significantly associated. Through the detection of related genes, predicting the efficacy of chemotherapy drugs and selecting appropriate drugs for individualized chemotherapy has become a reasonable choice to improve efficacy and reduce ineffective treatment. [0003] Individualized chemotherapy is based on the characteristics of pharmacogenetics and pharmacogenomics of cancer patients, using specific and optimal chem...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
Inventor 步迅张全芳刘艳艳冯孟秋
Owner 步迅
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products