UGT1A1 combined gene locus fluorescence detection kit for guiding irinotecan chemotherapeutic drug individualized treatment
A gene locus and chemotherapeutic drug technology, which is applied in the field of UGT1A1 combined gene locus fluorescence detection kits, can solve the problems of high occurrence rate and high cost of chip detection, and achieve low price, high-throughput detection, and easy promotion. Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0063] The invention provides a method for detecting UGT1A1*28, *6, *93, *60 gene loci.
[0064] 1. The 5' end of the probe used for UGT1A1*28 wild-type detection is labeled with FAM fluorescent dye, and the 5' end of the probe for mutant detection is labeled with JOE fluorescent dye; it is used for UGT1A1*6 (211G>A) The 5' end of the wild-type detection probe of the spot is labeled with FAM fluorescent dye, and the 5' end of the mutant-type detection probe is labeled with JOE fluorescent dye; the probe used for wild-type detection of UGT1A1*60 (-3279T>G) The 5' end of the needle is labeled with FAM fluorescent dye, the 5' end of the probe for mutant detection is labeled with JOE fluorescent dye; the 5' end of the wild-type detection probe for UGT1A1*93 (-3156G>A) site is labeled with FAM fluorescence Dye labeling, the 5' end of the probe for mutant detection is labeled with JOE fluorescent dye, and the 3' end is modified with BHQ1 or BHQ2.
[0065] The 1,700 samples to be te...
Embodiment 2
[0075] Embodiment 2: best primer and probe optimization test:
[0076] The invention designs a series of primers and probes in the research and development stage, and finally screens out a set of primers and probes with the strongest specificity and the best amplification efficiency through PCR conditions and system optimization.
[0077] Comparison of different probes under the same PCR conditions
[0078] probe name probe sequence 20140304P1 5′CACAGTCAAACATTAACTTGGTG 3′ 20140304P2 5′ACACACACAGCAGCAGGC 3′ W28_6*T1 5′cgcaGCCATATATATATAATAAGTAGACtgcg 3′ W28_6*T2 5′CGCGTGATTGGTTTTTGCCATATATATATATAAGTAGACGCG 3′ M28_7*T3 5′cgcagCCATATATATATATATAAGTAGGACtgcg 3′ M28_7*T4 5'CGCGTTGGTTTTTGCCATATATATATATATAAGTAGGACGCG 3' 20140304P3 5′AGTTGTCCTAGCACCTGACG 3′ 20140304P4 5′AAAACATTATGCCCGAGACT 3′ W6*T1 5′ ACGGAGCATTTTACACCTTGAAGAC 3′ M6*T2 5′CAGAGACAGAGCATTTTACACCTTGAA 3′ W6*T3 5′CGCGCGTGTTGTACATCAGAGACGGA...
Embodiment 3
[0087] Embodiment 3: specificity test
[0088] According to Example 1, the method of this kit was compared with the sequencing method for 20 samples, and the matching rate of the results was 100%. The test results are shown in Table 1.
[0089]
[0090]
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
