Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of fusion protein in cosmetics

A technology of fusion protein and cosmetics, applied in the application field of fusion protein in cosmetics, can solve the problem of no transdermal enhancement peptide, etc., achieve good biological activity and skin absorption rate, and maintain the effect of biological activity and skin absorption rate

Inactive Publication Date: 2016-04-20
GUANGDONG COOWAY BIOTECH CO LTD
View PDF3 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But there is no report that the skin penetration enhancing peptide is used in cosmetics in the prior art

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of fusion protein in cosmetics
  • Application of fusion protein in cosmetics
  • Application of fusion protein in cosmetics

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0065] Obtaining TD1-hSCGF Fusion Protein

[0066]The fusion protein is prepared by the following method: extracting total RNA from the foreskin tissue of healthy newborns or circumcised children, designing PCR primer F1 according to the full-length human hSCGF gene sequence (GenBankAccessionNO.BC005810.2), F2; F1: GAGTCCAGCTTAATGC, F2: AAGACACTAACAAGGAGGAG, RT-PCR amplified hSCGF cDNA, covalently linked TD1 (transdermal peptide) to the N-terminus of hSCGF, and obtained the TD1-hSCGF fusion gene; cloned it into the prokaryotic expression plasmid pET -22b (+), construct the expression vector pET-22b-TD1-hSCGF, transform the expression plasmid into E.coliRosetta (DE3), and pass the TD1-hSCGF fusion protein through Ni 2 + ChelatingSegparoseFastFlow purification to obtain fusion protein.

Embodiment 2

[0068] An active stock solution containing a fusion protein, by weight percentage, comprising the following components:

[0069]

[0070] Production Process:

[0071] 1. Heat phase A to 85°C and homogenize for 2-3 minutes to dissolve completely. Add phase B to A, stir and keep warm for 20 minutes and then start to cool down; 2. Cool down to about 65°C and add phase C, stir well and then add phase D; 3, 40 At about ℃, add E to pass the plate and discharge it.

Embodiment 3

[0073] A kind of repair network peptide film containing fusion protein, by weight percentage, comprises the following components:

[0074]

[0075] Production Process:

[0076] 1. Heat phase A to 85°C and homogenize for 2-5 minutes to completely dissolve, add phase B to A and stir to dissolve, keep warm for 30 minutes and start to cool down; 2. Cool down to about 55°C and add phase C; 3. Lower the temperature to about 40°C and add D relative plate qualified discharge.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides the application of fusion protein in cosmetics. The fusion protein contains a transdermal peptide and a human stem cell growth factor (hSCGF), and the transdermal peptide is connected to the N end or C end of the hSCGF through a linker peptide or in a covalent mode. The fusion protein can penetrate through intact skin more easily, and high biological activity and skin absorptivity can be maintained.

Description

technical field [0001] The invention relates to the application of a fusion protein in cosmetics, belonging to the field of daily chemical products. Background technique [0002] Stem cells are the origin cells of the human body. They are a kind of primitive undifferentiated cells with multi-directional differentiation potential and self-replication ability. They are the primitive cells that form various tissues and organs of mammals. The root cause of human aging is the aging of stem cells themselves. The vitality of stem cells to generate new cells will gradually decrease with age, so the skin will gradually lose its elasticity, aging, dull and other aging phenomena. hSCGF can quickly activate dormant skin stem cells and promote their growth, allowing skin stem cells to achieve the ability to activate, repair, and regenerate, regulate the microenvironment in the body, and provide a strong growth environment for skin stem cells. However, as a bioactive protein, hSCGF is di...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K19/00C07K14/475C12N15/70A61K8/64A61Q19/08A61Q19/02A61Q19/00
CPCC07K14/475A61K8/64A61Q19/00A61Q19/02A61Q19/08C07K2319/03
Inventor 陈松彬倪彦艳张爱萍吴纯玲
Owner GUANGDONG COOWAY BIOTECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com