Hepatic abscess-causing Klebsiella pneumoniae specific gene sequence asnc and its application

A technology for Klebsiella pneumoniae and Klebsiella liver, which is applied to the specific sequence asnC of Klebsiella pneumoniae gene and its application field, which can solve the easy missed diagnosis and delay the diagnosis of Klebsiella pneumoniae liver abscess , Low culture positive rate and other issues, to achieve high specificity

Inactive Publication Date: 2018-10-19
LISHUI CENT HOSPITAL
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the bacteria in the abscess cavity are mostly dead bacteria due to the use of antibiotics in the early stage of the patient and the phagocytosis and lysis of a large number of white blood cells, and the positive rate of culture is low
Klebsiella pneumoniae can be isolated and cultured from blood, combined with imaging results of liver abscess space, can also make a speculative diagnosis of Klebsiella pneumoniae liver abscess, but if it is an early liver abscess, the abscess cavity is hidden, and imaging The academic performance is not obvious, if you do not pay attention, it is easy to miss the diagnosis
In addition, blood culture takes a long time, and it takes 24-48 hours from the positive blood culture alarm to the final identification of the strain, which delays the diagnosis of Klebsiella pneumoniae liver abscess

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Hepatic abscess-causing Klebsiella pneumoniae specific gene sequence asnc and its application
  • Hepatic abscess-causing Klebsiella pneumoniae specific gene sequence asnc and its application
  • Hepatic abscess-causing Klebsiella pneumoniae specific gene sequence asnc and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] The screening process of specific gene sequences combines the next-generation sequencing technology (Next-Generation Sequencing, NGS), comparative genomics (Comparative Genomics) and bioinformatics (Bioinformatics) methods, and uses scientific statistical methods to analyze sequences in multiple The specificity of the distribution in the Klebsiella pneumoniae genome was tested, and PCR validation was performed in the isolated Klebsiella pneumoniae and non-hepatoabscess Klebsiella pneumoniae to determine the sequence in Klebsiella pneumoniae. Specificity in Lebsiella. The specific implementation process is as follows:

[0035] Pathogen isolation and identification:

[0036] 1. Enrollment of patients with suspected Klebsiella pneumoniae liver abscess. Patients with clinically suspected Klebsiella pneumoniae liver abscess were screened according to the following criteria:

[0037] (1) Clinical manifestations of the patient: fever, chills and abdominal pain;

[0038] (2...

Embodiment 2

[0061]Gene-specific verification:

[0062] The specific steps for the verification of three hepatic abscess-causing Klebsiella pneumoniae-specific genes in clinically isolated strains are:

[0063] 1. Select clinically isolated hepatic abscess and non-hepatic abscess Klebsiella pneumoniae bacterial strains for detection of sdm (shown in SEQ ID NO.1), lak (shown in SEQ ID NO.3) and asnC (shown in SEQ ID NO.3) .2) specificity in hepatoabscess-causing Klebsiella pneumoniae. 17 strains of Klebsiella pneumoniae isolated from the abscess of patients with liver abscess were selected as the detection group (hepatic abscess group), and 17 strains of Klebsiella pneumoniae isolated from non-Klebsiella pneumoniae patients with liver abscess were selected as negative controls group (non-hepatic abscess-induced group). At the same time, other common pathogenic bacteria (other pathogenic bacteria groups) isolated clinically were also selected to further verify the specificity of these fact...

Embodiment 3

[0086] Application of sdm, lak and asnC sequences or primers designed based on their sequences in the preparation of Klebsiella pneumoniae liver abscess diagnostic kit:

[0087] The design idea of ​​this experiment is as follows: the clinically obtained blood culture samples are divided into a blood culture positive group and a healthy person negative group, where the blood culture positive group refers to all samples with bacteria cultured in the blood, not limited to the blood cultured with pneumonia. Lebsiella, including cultures of other pathogenic bacteria. Use PCR to detect the presence of specific factors (i.e. sdm, lak and asnC) in positive blood culture samples and negative blood culture samples, and finally analyze the corresponding analysis of the PCR results and the patient's final clinical diagnosis, so as to judge whether the method provided by the present invention is suitable for Detection rate of Klebsiella pneumoniae liver abscess.

[0088] 1. Collection of ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a specific gene sequence asnC for klebsiella pneumoniae causing hepatic abscess and application thereof. The specific gene sequence asnC for klebsiella pneumoniae causing hepatic abscess is shown as SEQ ID NO. 2. Gene specificity exists in klebsiella pneumoniae causing hepatic abscess and can serve as a diagnosis marker for hepatic abscess caused by klebsiella pneumoniae. The invention further provides primers ATGCTGGATAAGAAAGATAAGGAG and GCATACTATTGACCTGCGAAACGAA aiming at the sequence asnC; specificity of the primers can amplify the sequence asnC. The sequence and the primers thereof have high specificity, and can be used for diagnosing hepatic abscess caused by klebsiella pneumoniae, and the sequence has commercial development value.

Description

technical field [0001] The invention relates to the field of medical disease diagnosis and drug selection for treatment, in particular to the gene-specific asnC sequence of Klebsiella pneumoniae causing liver abscess and its application. Background technique [0002] Klebsiella pneumoniae (K.pneumoniae subsp.pneumonia), belonging to the Enterobacteriaceae family, is negative for Gram staining, has a thick capsule, most of which have pili, no spores and flagella, and parasitizes human skin and nasopharynx It can cause severe pneumonia, urinary tract infection and bloodstream infection, etc. It is a common clinical opportunistic pathogen (Li B, Zhao Y, LiuC, Chen Z, Zhou D. Molecular pathogenesis of Klebsiella pneumoniae . Future Microbiol, 2014; 9(9): 1071-81). [0003] Liver Abscess (LA) is a secondary infectious disease that occurs in the liver, which can be caused by bacteria, fungi, parasites, etc. The center of the infected lesion liquefies necrosis, tissue dissolves, a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/689C12Q1/10C12N15/11C12R1/22
CPCC12Q1/689
Inventor 黄金伟涂建飞任建敏叶美萍曾春来尤伟波朱涛辉叶璟虞作春
Owner LISHUI CENT HOSPITAL
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap