Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

54results about How to "Improve the success rate of treatment" patented technology

LED Treatment of Dermatologic Toxicities Associated with Epidermal Growth Factor Receptor Inhibitors

The present invention relates generally to methods of preventing or treating toxicities of the skin, hair, and / or nails, which are associated with administration of one or more epidermal growth factor receptor inhibitors, with light-emitting diode photomodulation treatment, either alone or in combination with other agents.
Owner:DELAND MAITLAND M +1

Identification method, identification device and storage medium for cancer

The invention discloses an identification method, and identification device and a storage medium for cancer. The identification method for cancer includes receiving a pathologic picture in the preparation of cancer identification, confirming the model of preset type corresponding to the pathologic picture in accordance with the mapping relation between the cancer type in the preparation of identification and the model of preset type; undertaking the identification process on the pathologic picture on the basis of the confirmed model of preset type and producing the result of identification. Byidentifying the picture segment in the cancerous region of the pathologic picture and judging whether the patients with the pathologic picture is afflicted with cancer, the identification method forcancer can improves the efficiency of identifying cancer.
Owner:PING AN TECH (SHENZHEN) CO LTD

Ointment for rhinitis

Ointment for rhinitis is disclosed. The ointment includes main materials and auxiliary materials. The main materials include small centipeda herb, dahurian angelica roots, biond magnolia flower-bud, siberian cocklebur fruit, manchurian wildginger, mint and borneol, and include, by weight, 5-15 g of small centipeda herb, 8-12 g of dahurian angelica roots, 6-14 g of biond magnolia flower-bud, 10-20g of siberian cocklebur fruit, 8-12 g of manchurian wildginger, 3-7 g of and 1-7 g of borneol. The auxiliary materials include sesame oil, vaseline and qingliang oil. The ointment has antibacterial, anti-inflammatory, bacteriostatic and antipruritic effects, and has assistant improving and relieving effects for allergic rhinitis, sinusitis and various types of allergic rhinitis caused by dust mites. The ointment after long-term use can achieve a radical treatment effect and the success rate of treatment is extremely high. The sesame oil and the qingliang oil are added in the raw materials so that flavor of herbal medicines is reduced and the ointment is suitable for more people.
Owner:深圳神思汉方生物科技有限公司

Vascular radio-frequency ablation electrode catheter provided with claw-shaped catheter branches

The invention relates to the technical field of medical apparatuses, and in particular to a vascular radio-frequency ablation electrode catheter provided with claw-shaped catheter branches; a radio-frequency ablation working section is arranged on the front section of the vascular radio-frequency ablation electrode catheter , a catheter body section is arranged on the middle section of the vascular radio-frequency ablation electrode catheter and a control handle section is arranged on the rear section of the vascular radio-frequency ablation electrode catheter; the eight radio-frequency catheter branches extend from a peripheral direction of the radio-frequency ablation working section; the eight radio-frequency catheter branches are integrally represented as claw-shaped structures; and at least one ablation electrode is connected to the head end of each radio-frequency catheter branch. The vascular radio-frequency ablation electrode catheter provided by the invention has the beneficial effects that in practical clinical treatment, the vascular radio-frequency ablation electrode catheter provided with the claw-shaped catheter branches provided by the invention can be applied to various blood vessels differing in diameter and can be used for conducting radio-frequency ablation therapy on cardiac muscle tissues in a complex part, such as for vascular ablation of such diseases as paroxysmal atrial tachycardia, supraventricular tachycardia, atrial flutter, atrial fibrillation, resistant hypertension and the like.
Owner:汤敬东 +2

Air passage control system of tee joint vacuum valve in use for stone crusher of ballistic curve

InactiveCN1795830AStable shock actionAdapt to operational needsSurgeryControl systemAir pump
An air channel controlling system of three-way vacuum valve for the ballistic lithotriptor is composed of a handset module, three-way vacuum valve module consisting of the valve body with 4 air channels and the valve core with 3 air channels, the connecting flexible tube and high-pressure air pump. It has high successful rate and safety.
Owner:HANGZHOU HAWK OPTICAL ELECTRONICS INSTR CO LTD

LED Treatment of Dermatologic Toxicities Associated with Multikinase Inhibitors

The present invention relates generally to methods of preventing or treating toxicities of the skin, hair, and / or nails, which are associated with administration of one or more multikinase inhibitors, with light-emitting diode photomodulation treatment, either alone or in combination with other agents.
Owner:DELAND M MAITLAND +1

Sacral nerve puncture guide plate and construction method thereof

ActiveCN112244956AAvoid puncture errorsEnsuring Structural AccuracySpinal electrodesAdditive manufacturing apparatusGuide tubeBiomedical engineering
The invention provides a sacral nerve puncture guide plate and a construction method thereof. The guide plate comprises a base plate, an outer guide pipe and an inner guide pipe, wherein the outer guide pipe is arranged on the outer side face of the base plate; the inner guide pipe is coaxially arranged in the outer guide pipe; the inner guide pipe penetrates through the base plate; and the end face of the end, penetrating through the base plate, of the inner guide pipe is flush with the inner side face of the base plate. According to the sacral nerve puncture guide plate provided by the invention, the end face of the end, penetrating through the base plate, of the inner guide pipe is flush with the inner side face of the base plate, so that the tail end face of the inner guide pipe directly abuts against the skin in use and can be attached to the surface of the skin, whole-course guided puncture is achieved, and puncture errors are avoided.
Owner:西安点云生物科技有限公司

LED Treatment of Dermatologic Toxicities Associated with Vascular Endothelial Growth Factor Inhibitors

InactiveUS20110196352A1Prevent toxicityTreating preventing toxicitySurgical instrument detailsLight therapyFactor iiVascular Endothelial Growth Factor Receptor
The present invention relates generally to methods of preventing or treating toxicities of the skin, hair, and / or nails, which are associated with administration of one or more vascular endothelial growth factor receptor inhibitors, with light-emitting diode photomodulation treatment, either alone or in combination with other agents.
Owner:DELAND M MAITLAND +1

Bacterial drug resistance fluorescence detection method and diagnostic kit thereof

The invention provides a fluorescence detection method for detecting bacterial drug resistance in an individual and a diagnostic kit / diagnostic reagent thereof. According to the fluorescence detection method, absorbance difference under the condition of different wavelengths is detected by using a fluorogenic substrate, which only can be degraded by broad spectrum beta lactamase, through double fluorescence signals and further the bacterial drug resistance of the individual or the biological sample of the individual can be detected. The detection method and the obtained detection kit based on the method can detect the 3rd and 4th generations of drug-resistance bacteria of cephalosporin, which cannot be detected by products available in the markets and can reach a detection value of 10<5>-10<8> drug-resistance bacteria, so that a market blank is filled in, more effective monitoring method and use guide are provided for the use of antibiotics in clinic, and extremely great practical values are achieved.
Owner:SHANGHAI BAIKE BIO TECH CO LTD

Porous metal rod

The invention relates to a porous metal rod for medical implanting used for treating early-stage and middle-stage femoral head necrosis. The porous metal rod comprises two parts, wherein one part is a round-rod-shaped part, the other part connected with the round-rod-shaped part is a threaded part, threads are arranged on the outer part of the threaded part, the outer diameter of the threads is greater than that of the round rod shape, a notch is formed in the end face of the threaded part, the outer diameter of one section, close to the round rod shape, of the threaded part is gradually reduced towards the round-rod-shaped part, so that the stress at the joint of the threaded part and the round-rod-shaped part is reduced, thus the fracture failure of the porous metal rod can be avoided, and finally, the treatment success rate is improved.
Owner:CHONGQING RUNZE PHARM CO LTD

Replacement cartridge

The invention concerns a replacement cartridge for producing an aerosol, having at least one base element (1) and at least one cover element (2), a reservoir for a first, in particular, liquid, aerosol component being formed in the base element and / or the cover element, an atomizing nozzle (5, 6) being formed in the replacement cartridge, and the base element and cover element being connected to one another by means of a bayonet closure.
Owner:MEDIC ACTIV VERTRIEBS

Emergency treatment quality evaluation management system

An emergency treatment quality evaluation management system comprises a patient registration system, an emergency treatment system, a data acquisition system, a data processing system and a managementevaluation system. The patient registration system is used for collecting basic identity information of a patient; the emergency treatment system is used for recording treatment first-aid informationof the patient, wherein the treatment first-aid information comprises disease information, treatment duration information and treatment result information of the patient; the data processing system comprises a data classification module, a data proofreading module, a data analysis module and a data evaluation summary sheet; and the management evaluation system comprises a data query module, a statistics module, a case classification module and a key case storage module. According to the system, not only can the treatment process of the disease be analyzed and evaluated, but also treatment failure cases can be analyzed, and thus the overall treatment success rate is improved.
Owner:张彩东

LED treatment of dermatologic toxicities associated with multikinase inhibitors

The present invention relates generally to methods of preventing or treating toxicities of the skin, hair, and / or nails, which are associated with administration of one or more multikinase inhibitors, with light-emitting diode photomodulation treatment, either alone or in combination with other agents.
Owner:DELAND M MAITLAND +1

Molecular detection kit for klebsiella pneumoniae causing hepatic abscess and application thereof

The invention discloses a molecular detection kit for klebsiella pneumoniae causing hepatic abscess and an application thereof. The invention provides gene specific sequences pagO and luxR of klebsiella pneumoniae causing hepatic abscess, two genes are specially existed in the klebsiella pneumoniae causing hepatic abscess, and can be taken as a diagnostic marker of klebsiella pneumoniae causing hepatic abscess. The primers of design of two genes can be used for preparing the molecular detection kit for klebsiella pneumoniae causing hepatic abscess, the kit can be used for diagnosis or early diagnosis of the molecular detection kit for klebsiella pneumoniae causing hepatic abscess, and has great commercialized exploitation value.
Owner:NANJING FIRST HOSPITAL

LED treatment of dermatologic toxicities associated with vascular endothelial growth factor inhibitors

The present invention relates generally to methods of preventing or treating toxicities of the skin, hair, and / or nails, which are associated with administration of one or more vascular endothelial growth factor receptor inhibitors, with light-emitting diode photomodulation treatment, either alone or in combination with other agents.
Owner:DELAND M MAITLAND +1

Method for automatically extracting feature points of digital model of preoperative nasal-alveolar process appliance

The invention discloses a method for automatically extracting feature points of a digital model of a preoperative nasal-alveolar process appliance. The method comprises the following steps: S1, acquiring an oral impression model file and preprocessing the oral impression model file; S2, performing coordinate system transformation on the preprocessed oral impression model; S3, performing segmentation processing on the oral impression model after coordinate system transformation; S4, performing two-dimensional plane projection on digital models of the alveolar bones on the two sides, and performing image fitting on the projected images of the alveolar bones on the two sides to obtain a fitting graph; and S5, performing side plane projection on the alveolar bones of the healthy side and the affected side according to the fitting graph, segmenting a ridge line according to the side plane projection, and extracting feature point coordinates according to the trend of the ridge line. Dimension reduction processing is performed on three-dimensional digital model data, and feature points are extracted by using image fitting and feature recognition technologies; the method can provide guidance for the design of a preoperative cleft lip and palate correction model, reduces the operation risk, improves the correction success rate, and has good commercial prospect and values.
Owner:WUHAN UNIV

Compound medicine for treating diabetes

The present invention provides a compound drug for treating diabetes, the compound drug is prepared by berberine intestinal controlled-release microcapsules and a common western medicine for treating diabetes, 10 to 90 percent of the daily maximum dose of the berberine which is the active ingredient in the berberine intestinal controlled-release microcapsules and 90 to 10 percent of the daily maximum dose of the active ingredient of one common western medicine which is chosen randomly for treating diabetes are used for compound preparation. The berberine intestinal controlled-release microcapsules used in the compound drug of the present invention are the effective drug for treating diabetes, and the microcapsule diameter is 35 to 5000 Mum. The present invention provides the compound drug for treating diabetes, which mainly makes use of the complementary synergistic effect of the main drugs to achieve the purpose of reducing the blood glucose. The compound drug of the present invention for treating diabetes has high treatment success rate, less toxicity, fewer side effects and lower dose; furthermore, the present invention can effectively improve the compliance of the medication of the patients, so as to enhance the effect of reducing blood glucose of the drugs treating diabetes.
Owner:左仁杰 +4

Wulong bone pain plaster

The invention provides a Wulong bone pain plaster. The Wulong bone pain plaster is prepared from raw materials by weight as follows: one white-dappled snake, 25 g of cassia twigs, 35 g of frankincense, 20 g of crude Sichuan aconite roots, 20 g of raw kusnezoff monkshood roots, 45 g of notopterygium roots, 25 g of radix angelicae pubescentis, 35 g of cortex eucommiae, 50 g of radix clematidis, 75 gof caulis spatholobi, 50 g of common clubmoss herbs, 35 g of garden balsam stems, 8 g of semen momordicae, 7 g of raw semen strychni, 25 g of common bletilla tuber, 35 g of dragon's blood, 45 g of rhizoma dioscoreae nipponicae, 50 g of radix saposhnikoviae, 10 g of borneol, 20 g of camphor, 2,000 g of sesame oil and 1,000 g of yellow lead. The Wulong bone pain plaster is obtained by mixing and blending traditional Chinese medicinal materials including the white-dappled snake, the notopterygium roots, the raw semen strychni and the like in a specific proportion, has good curative effects on hyperostosis, cervical spondylosis, waist and leg pain, lumbar disc herniation, knee arthritis, rheumatic bone pain, arthritis, scapulohumeral periarthritis and sciatica and has the treatment success rate high to 98%; and the plaster is prepared from pure natural traditional Chinese medicinal materials, has the algetic rate of 1 / 10,000 and is safe to use and good in curative effect.
Owner:王凯

Analysis method for diversity of acute lung injury intestinal flora

PendingCN112582029AJudgment detailsJudging the recoveryMicrobiological testing/measurementBiostatisticsGenomic sequencingDiversity index
The invention discloses an analysis method for the diversity of acute lung injury intestinal flora, relates to the technical field of acute lung injury intestinal flora diversity analysis, and particularly relates to an analysis method for the diversity of the acute lung injury intestinal flora. The analysis method which comprises the steps of S1, collecting a sample; S2, extracting DNA of the sample DNA; S3, carrying out PCR amplification; and S4, carrying out data information analysis, specifically, S401, conducting effective sequence statistics; S402, performing effective sequence length distribution statistics; S403, carrying out OUT clustering and species information annotation; S404, obtaining a diversity index; and S405, carrying out metagenome sequencing analysis. According to themethod for analyzing the diversity of the acute lung injury intestinal flora, detailed specific values of a patient can be effectively obtained according to the diversity of the acute lung injury intestinal flora and compared with standard data values, the detailed situation of the lung of the patient can be effectively judged, and a detailed table can be issued for filing. so that targeted treatment can be effectively carried out according to the lung condition of the patient.
Owner:李志军

Externally fixing reductor for disclocated vertebral column

The present invention relates to external fixing restorer used for treating human body spinal column slippage, it is composed of upper and lower supporting mechanisms and intermediate suspension mechanism, the upper, lower supporting mechanisms are same in structure and are respectively composed of supporting plate and a pair of regulatable supporting nail; the suspension mechanism is composed of horizontal bar, pulling bar and traction nail, the horizontal bar is connected with pulling bar by pulling rod, a pair of adjustable traction nail are set on the pulling bar, the two ends of horizontal bar are regulatably connected with corresponding two long screws, the middle part of horizontal bar is regulatably connected with a long screw at its backside. Advantages: small wound during treating, high treating success rate, easy assembling and disassembling of apparatus, etc.
Owner:JIANGSU PROVINCE HOSPITAL

Ache-Nmda Combination Wafer

Sheet-like pharmaceutical preparations based on hydrophilic polymers, which rapidly disintegrate upon contact with moisture and which are used to treat dementia-related illnesses The dosage form contains an active agent combination of at least two active agents which are suitable for the treatment of dementia (antidementia agents). The antidementia agents should be chosen from the group comprising acetyl cholinesterase inhibitors (AChE inhibitors) and NMDA antagonists (n-methyl-D-asparaginic acid antagonists). The use of such an active agent combination for producing an orally administrable pharmaceutical product for the treatment of dementia-related illnesses such as Alzheimer's disease, as well as a procedure for the symptomatic treatment of Alzheimer's disease by the oral administration of one of the above pharmaceutical products is also provided.
Owner:LTS LOHMANN THERAPIE-SYST AG

Local pollution-free positive pressure isolation system

The invention discloses a local pollution-free positive pressure isolation system which comprises a positive pressure ward, a positive pressure adjusting device is arranged on the positive pressure ward, and the positive pressure adjusting device comprises an intelligent disinfection device, an exhaust fan, a drug-resistant bacterium sterilization device, an isolation container, an automatic exhaust valve, an air interchanger and a control device. The intelligent disinfection device is fixed to the positive pressure ward and used for conducting automatic spraying disinfection on the positive pressure ward, the exhaust fan is connected with the interior of the positive pressure ward and the interior of the drug-resistant bacterium sterilization device through a gas collection pipeline, and according to the local pollution-free positive pressure isolation system, the sterile state before the isolation container is used can be achieved, the system cannot be polluted by environmental microorganisms during isolation, so that anti-pollution isolation is achieved, the positive pressure state in the ward can be maintained all the time, meanwhile, the arranged intelligent disinfection device can automatically and regularly disinfect the interior of the positive pressure ward, an intelligent process is adopted in the whole process, the working efficiency is improved, and manpower input is not needed.
Owner:山东博思生物技术有限公司

Selection method of non-intravenous injection treatment injection point

ActiveCN112927199AClear distributionAccurate and reliable selectionImage enhancementImage analysisGray levelRadiology
A selection method of a non-intravenous injection treatment injection point comprises the steps: S1, using a near-infrared imaging device for imaging a to-be-injected part of a user, and obtaining a near-infrared vein image ORIGINAL of the to-be-injected part; S2, performing preprocessing such as cutting and zooming on the near-infrared vein image ORIGINAL obtained in the S1, and obtaining a gray level image GRAY; S3, carrying out gray level normalization processing on the gray level image GRAY obtained in the S2, and obtaining a normalized gray level image NORM; S4, carrying out image binarization operation on the normalized gray level image NORM obtained in the step S3 to obtain a near-infrared binary image BINARY; S5, carrying out filtering operation on the near-infrared binary image BINARY obtained in the step S4, and obtaining a vascular binary image VESSEL; and S6, acquiring candidate pixel points for the vascular binary image VESSEL obtained in the S5, respectively calculating the size of a range square of each candidate pixel point, and comparing to obtain pixel point positions corresponding to one or more specific positions most suitable for being used as injection points, thereby completing the selection of a non-intravenous injection treatment injection point.
Owner:TONGJI UNIV

Bacteriostatic, anti-inflammatory, antipruritic and acne-removing garlic ointment as well as preparation method and application thereof

The invention relates to the fields of garlic products and applications thereof, and in particular to a bacteriostatic, anti-inflammatory, antipruritic and acne-removing garlic ointment as well as a preparation method and an application thereof. The bacteriostatic, anti-inflammatory, antipruritic and acne-removing garlic ointment consists of the following raw materials: a substance containing alliin and allinase, albolene, glyceryl stearate, liquid paraffin and peppermint oil. The bacteriostatic, anti-inflammatory, antipruritic and acne-removing garlic ointment, for acne as well as pruritus caused by mosquito bites or / and inflammation or / and bacterial infection or / and fungal or viral infection or / and eczema, has the advantages of being rapid to take effects, good in curative effect, natural and non-irritant, free from toxic and side effects, convenient to use and high in success rate in treatment, and the garlic ointment is excellent in bacteriostatic effect; in addition, the preparation method of the bacteriostatic, anti-inflammatory, antipruritic and acne-removing garlic ointment is simple; and on the basis of the advantages, the bacteriostatic, anti-inflammatory, antipruritic and acne-removing garlic ointment has a better application prospect.
Owner:XINJIANG AILEXIN PHARMA

Hickory nut root disease control method

The invention discloses a hickory nut root disease control method, and belongs to the technical field of seedling disease and pest control. The method comprises the following steps: dividing root diseases of hickory nut trees into three levels according to the degrees of disease severity; carrying out soil loosening; carrying out pouring or filling holes with a fertilizer-pesticide mixed solution; and solarizing the soil. The method has the advantages of practicability and wide active range, and often shows consistent performance in agriculture compared with a biological treatment method.
Owner:浙江石原金牛化工有限公司

Mycobacterium tuberculosis mutant gene and application thereof

The present invention belongs-the technical field of biomedicines and provides a mycobacterium tuberculosis mutant gene and an application thereof. The mutant gene is a mutant gene in which an Rv1527cgene fragment is deleted in a H37Rv gene of a standard strain of mycobacterium tuberculosis, or a mutant gene with an alanine at 1380th position on the Rv1527c gene fragment of the mycobacterium tuberculosis is mutated to proline or glycine at 1637th position is mutated to alanine. The mutant gene is used as a biomarker of the mycobacterium tuberculosis for detection of clinical specimens of tuberculosis patients before treatment and conducive-clinical formulation of reasonable chemotherapy regimens, and thus improves a clinical successful treatment rate of tuberculosis patients, especially multidrug-resistant tuberculosis patients.
Owner:AFFILIATED HOSPITAL OF ZUNYI UNIV

Dental material as well as preparation method and application thereof

The invention provides a dental material. The dental material comprises a resin root canal sealant and DMADDDM, and also comprises magnetic nanoparticles (MNPs). The material can improve the dentin tubule permeability and antibacterial properties of the root canal sealant while maintaining the material properties of the sealant, so that the purpose of preparing a novel resin-type root canal sealant material with effective antibacterial properties and dentin permeability is achieved.
Owner:SICHUAN UNIV

Hepatic abscess-causing Klebsiella pneumoniae specific gene sequence asnc and its application

InactiveCN105506087BComprehensive search analysisSystem search analysisMicrobiological testing/measurementMicroorganism based processesMicrobiologyGene
The invention provides a specific gene sequence asnC for klebsiella pneumoniae causing hepatic abscess and application thereof. The specific gene sequence asnC for klebsiella pneumoniae causing hepatic abscess is shown as SEQ ID NO. 2. Gene specificity exists in klebsiella pneumoniae causing hepatic abscess and can serve as a diagnosis marker for hepatic abscess caused by klebsiella pneumoniae. The invention further provides primers ATGCTGGATAAGAAAGATAAGGAG and GCATACTATTGACCTGCGAAACGAA aiming at the sequence asnC; specificity of the primers can amplify the sequence asnC. The sequence and the primers thereof have high specificity, and can be used for diagnosing hepatic abscess caused by klebsiella pneumoniae, and the sequence has commercial development value.
Owner:LISHUI CENT HOSPITAL

A molecular detection kit for hepatic abscess-causing Klebsiella pneumoniae and its application

The invention discloses a molecular detection kit for klebsiella pneumoniae causing hepatic abscess and an application thereof. The invention provides gene specific sequences pagO and luxR of klebsiella pneumoniae causing hepatic abscess, two genes are specially existed in the klebsiella pneumoniae causing hepatic abscess, and can be taken as a diagnostic marker of klebsiella pneumoniae causing hepatic abscess. The primers of design of two genes can be used for preparing the molecular detection kit for klebsiella pneumoniae causing hepatic abscess, the kit can be used for diagnosis or early diagnosis of the molecular detection kit for klebsiella pneumoniae causing hepatic abscess, and has great commercialized exploitation value.
Owner:NANJING FIRST HOSPITAL

Liver abscess inducing Klebsiella pneumonia specific gene sequence and application thereof

ActiveCN105420381AComprehensive search analysisSystem search analysisMicrobiological testing/measurementMicroorganism based processesBiologyGene
The invention provides a liver abscess inducing Klebsiella pneumonia specific gene sequence and an application thereof. The sequence of the liver abscess inducing Klebsiella pneumonia specific gene sequence sdm is represented by SEQ ID NO.1. The gene specifically exists in liver abscess inducing Klebsiella pneumonia, and can be used as a Klebsiella pneumonia induced liver abscess diagnosis marker. The invention also provides primers TTGAATCTTACCCAGAGGAACTT and AACAGCACCTTTCACAACGACAT of the sdm sequence. The primers can specifically amplify the sdm sequence. The sequence and the primers thereof, provided by the invention, have very high specificity, can be used to diagnose Klebsiella pneumonia induced liver abscess, and have commercial exploitation values.
Owner:AFFILIATED HUSN HOSPITAL OF FUDAN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More