Artificial noncoding RNAs containing inverted sineb2 repeats and their use in enhancing translation of target proteins
A sequence and protein technology, applied in the field of artificial non-coding RNA and its ability to enhance target protein translation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] Example 1 The transcription of endogenous natural RNAe has a variable tailing method, and artificial AT-RNAe is constructed in this way
[0041] The main experimental techniques are as follows:
[0042] (1) Cell transfection: The confluent HEK293T cells were digested with 0.05% trypsin-EDTA (Gibco, USA), and inoculated in 10% fetal bovine serum (FBS, Gibco, USA), 100units / mL penicillin penicillin ( Biodee, China), 0.1mg / mL streptomycin (Biodee, China) in DMEM medium (Gibco, USA) in a 12-well cell culture plate, cultivated at 37°C and 5% CO2 until the confluence reached 70%~ After 90%, use Lipofectamine TM 3000 reagent (Invitrogen Company, USA), the plasmid expressing the target protein at 0.3 μg per well (as in figure 1 For the pEGFP-C1 used in D), the amount of the plasmid containing the corresponding RNAe was 1.2 μg per well, and the plasmid was transfected into the cells, and detected after culturing for 48 hours.
[0043] (2) qRT-PCR: After removing the culture m...
Embodiment 2
[0056] Example 2 The pairing region with the target mRNA and the inverted SINEB2 sequence are sufficient conditions for RNAe to function, and artificial minRNAe is constructed using this
[0057] Carrieri et al. (Carrieri et al., Long non-coding antisense RNA controls Uchl1translation through an embedded SINEB2 repeat; Nature. 2012; 491(7424):454-7) demonstrated the necessity of the inverted SINEB2 sequence for AS Uchl1, based on which Above, we proved that the inverted SINEB2 sequence is a sufficient condition for RNAe molecules outside the pairing region to function, and constructed artificial minRNAe based on this.
[0058]We respectively truncated the partial sequence after SINEB2 in the RNAe sequence of pRNAe-egfpc1 (see the italicized tail part of the pRNAe-egfpc1 sequence in Example 1): after SINEB2, after ALU, and the full length of the tail is 827nt sequence The sequence after the 227th, 427th, and 627th positions (but retain poly(A)), pminRNAe-egfpc1 (no tail part), ...
Embodiment 3
[0059] Example 3 Optimization of the RNAe pairing region can improve its translation enhancement efficiency
[0060] We first studied the pairing region between the RNAe molecule and the target mRNA, and found that the part paired with the 5'-TR (translated region) is more important for the function of the RNAe molecule than the part paired with the 5'-UTR (untranslated region). And the optimization of the paired region can improve the translation promotion efficiency of RNAe molecules.
[0061] We constructed an RNAe (40:0, 100:0) (pRNAe-egfpn1-40:0 (the sequence of the pairing part is GGTGGCGACCGGTGGATCCCGGGCCCGCGGTACCGTCGAC) that only pairs with the EGFP mRNA5'-UTR in the pEGFP-N1 plasmid (product of Clonetech), pRNAe -egfpn1-100:0 (paired sequence is GGTGGCGACCGGTGGATCCCGGGCCCGCGGTACCGTCGACTGCAGAATTCGAAGCTTGAGCTCGAGATCTGAGTCCGGTAGCGCTAGCGGATCTGACGGT)), and RNAe paired only with EGFP mRNA 5'-TR in pEGFP-N1 plasmid (0:32,0:100,0:200)(pRNA1-0:f 32(配对序列为为CCGGTGAACAGCTCCTCGCCC...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


