Artificial noncoding RNAs containing inverted sineb2 repeats and their use in enhancing translation of target proteins

A sequence and protein technology, applied in the field of artificial non-coding RNA and its ability to enhance target protein translation

Active Publication Date: 2021-07-16
TSINGHUA UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But apart from microRNA and siRNA, no other RNA-based mechanisms have been widely used as tools for gene expression regulation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Artificial noncoding RNAs containing inverted sineb2 repeats and their use in enhancing translation of target proteins
  • Artificial noncoding RNAs containing inverted sineb2 repeats and their use in enhancing translation of target proteins
  • Artificial noncoding RNAs containing inverted sineb2 repeats and their use in enhancing translation of target proteins

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1 The transcription of endogenous natural RNAe has a variable tailing method, and artificial AT-RNAe is constructed in this way

[0041] The main experimental techniques are as follows:

[0042] (1) Cell transfection: The confluent HEK293T cells were digested with 0.05% trypsin-EDTA (Gibco, USA), and inoculated in 10% fetal bovine serum (FBS, Gibco, USA), 100units / mL penicillin penicillin ( Biodee, China), 0.1mg / mL streptomycin (Biodee, China) in DMEM medium (Gibco, USA) in a 12-well cell culture plate, cultivated at 37°C and 5% CO2 until the confluence reached 70%~ After 90%, use Lipofectamine TM 3000 reagent (Invitrogen Company, USA), the plasmid expressing the target protein at 0.3 μg per well (as in figure 1 For the pEGFP-C1 used in D), the amount of the plasmid containing the corresponding RNAe was 1.2 μg per well, and the plasmid was transfected into the cells, and detected after culturing for 48 hours.

[0043] (2) qRT-PCR: After removing the culture m...

Embodiment 2

[0056] Example 2 The pairing region with the target mRNA and the inverted SINEB2 sequence are sufficient conditions for RNAe to function, and artificial minRNAe is constructed using this

[0057] Carrieri et al. (Carrieri et al., Long non-coding antisense RNA controls Uchl1translation through an embedded SINEB2 repeat; Nature. 2012; 491(7424):454-7) demonstrated the necessity of the inverted SINEB2 sequence for AS Uchl1, based on which Above, we proved that the inverted SINEB2 sequence is a sufficient condition for RNAe molecules outside the pairing region to function, and constructed artificial minRNAe based on this.

[0058]We respectively truncated the partial sequence after SINEB2 in the RNAe sequence of pRNAe-egfpc1 (see the italicized tail part of the pRNAe-egfpc1 sequence in Example 1): after SINEB2, after ALU, and the full length of the tail is 827nt sequence The sequence after the 227th, 427th, and 627th positions (but retain poly(A)), pminRNAe-egfpc1 (no tail part), ...

Embodiment 3

[0059] Example 3 Optimization of the RNAe pairing region can improve its translation enhancement efficiency

[0060] We first studied the pairing region between the RNAe molecule and the target mRNA, and found that the part paired with the 5'-TR (translated region) is more important for the function of the RNAe molecule than the part paired with the 5'-UTR (untranslated region). And the optimization of the paired region can improve the translation promotion efficiency of RNAe molecules.

[0061] We constructed an RNAe (40:0, 100:0) (pRNAe-egfpn1-40:0 (the sequence of the pairing part is GGTGGCGACCGGTGGATCCCGGGCCCGCGGTACCGTCGAC) that only pairs with the EGFP mRNA5'-UTR in the pEGFP-N1 plasmid (product of Clonetech), pRNAe -egfpn1-100:0 (paired sequence is GGTGGCGACCGGTGGATCCCGGGCCCGCGGTACCGTCGACTGCAGAATTCGAAGCTTGAGCTCGAGATCTGAGTCCGGTAGCGCTAGCGGATCTGACGGT)), and RNAe paired only with EGFP mRNA 5'-TR in pEGFP-N1 plasmid (0:32,0:100,0:200)(pRNA1-0:f 32(配对序列为为CCGGTGAACAGCTCCTCGCCC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to an artificial non-coding RNA containing an inverted SINEB2 repeat sequence and its use in enhancing the translation of a target protein. Specifically, the present invention provides a nucleic acid molecule, which is: (1) an RNA molecule consisting of the following elements: a pairing region complementary to the target mRNA, an inverted SINEB2 sequence, and an optional poly(A) signal region , and optionally regulatory elements; or (2) a DNA molecule capable of transcribing the RNA molecule.

Description

technical field [0001] The present invention relates to the field of biotechnology, more specifically, relates to artificial non-coding RNA containing inverted SINEB2 repeat sequence and its application in enhancing target protein translation. Background technique [0002] Non-coding RNA transcripts are ubiquitous in cells, but the functions of most are unknown. Some were found to regulate gene expression at the transcriptional level. In 2012, Carrieri et al. (Carrieri et al., Long non-codingantisense RNA controls Uchl1 translation through an embedded SINEB2repeat; Nature.2012; 491(7424):454-7) reported a class of long non-coding RNAs with new functions ( lncRNA), which targets the 5' end of mRNA (messenger RNA) through an overlapping antisense sequence, thereby increasing the translation of the corresponding protein UCHL1 at the post-transcriptional level, possibly because this lncRNA can complement mRNA and promote ribosome recruitment . This finding expands our underst...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/113C12N15/63C12Q1/02
CPCC12N15/113C12N15/63C12Q1/02
Inventor吴琼姚绎金守红龙海舟余瑛婷
OwnerTSINGHUA UNIV