Check patentability & draft patents in minutes with Patsnap Eureka AI!

Wlofberry phytochelatin synthetase as well as coding gene and application thereof

A technology of encoding genes and synthetases, which is applied in the fields of Lycium barbarum phytochelatin synthetase and encoding genes and applications, can solve the problems of heavy screening workload, long breeding time, and high technical requirements, and achieve high tolerance to cadmium ions, The effect of high salt tolerance

Inactive Publication Date: 2016-07-13
TIANJIN UNIV
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Nowadays, lodging resistance, disease resistance, insect resistance and other traits of plants can be obtained through breeding technology, but the traits of plants' ability to resist oxidative stress in various adversities still need to be improved
[0005] The methods commonly used to screen and cultivate new varieties of crops include: conventional hybrid breeding technology, mutagenesis technology, and molecular marker technology. Building a library requires high technical requirements

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Wlofberry phytochelatin synthetase as well as coding gene and application thereof
  • Wlofberry phytochelatin synthetase as well as coding gene and application thereof
  • Wlofberry phytochelatin synthetase as well as coding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Cloning of Phytochelatin Synthase LcPCS Gene from Lycium barbarum

[0031] Using Trizol reagent, total RNA was extracted from 100 mg of fresh Lycium barbarum (Chinese wolfberry) leaves, using the Transgentransecriptone-stepgDNAremovalandcDNAsynthesissupermix kit, using Lycium barbarum total RNA as a template, OligodT 18 As a primer, the first strand of cDNA was synthesized under the action of AMV reverse transcriptase.

[0032] According to the Unigene sequence design of Lycium barbarum transcriptome database, the upstream primer P1 shown in SEQIDNO.3: 5'ATGGCGATGGCGGGTT3' and the downstream primer P2 shown in SEQIDNO.4: 5'CTAAAAGGGAGGTGCAGTCA3' were obtained by landing PCR (TD-PCR) (see figure 1 .), and then use Tiangen Company’s ordinary DNA product purification kit to purify the PCR reaction product to obtain the purified LcPCSPCR fragment, and operate according to the kit instructions.

[0033] The PCR product sequence was sequenced and verified, and a sequence wit...

Embodiment 2

[0035] Construction process of recombinant vector pMD18-T-LcPCS

[0036] The LcPCS gene shown in the sequence table SEQIDNO.2 is connected to the pMD18-T vector,

[0037] Reaction conditions: 16°C, 30min. The ligation product was transformed into E.Coli.Top10. Pick white colonies, colony PCR method to confirm the length of the insert in the T vector, such as figure 2 , as expected, the vector was sent to Huada Gene Company for sequencing, and we obtained the 1506bp deoxynucleotide sequence of the gene, which was blasted at NCBI, which showed high homology with tomato, potato, etc., indicating that the gene was cloned successfully . The LcPCS deoxynucleotide sequence and the pMD18-T sequence were spliced ​​and assembled into the cloning vector pMD18-T-LcPCS, such as image 3 shown.

Embodiment 3

[0039] Construction process of prokaryotic recombinant expression vector pET28a-LcPCS in Escherichia coli

[0040] First, the pMD18-T-LcPCS plasmid is used as a template, and the P3 (CGC) shown in SEQ ID NO.5 GGATCC ATGGCGATGGCGGGTT), P4 shown in SEQ ID NO.6 (ACGC GTC GAC CTAAAAGGGAGGTGCAGTCA) are the upstream and downstream primers respectively to amplify the LcPCS gene. The reaction conditions are: 94°C, 4min; (94°C, 30Sec; 56°C, 30Sec; 72°C, 1min50Sec) 32cycles; 72°C, 8min. There is a BamHI restriction site (GGATCC) in P3 and a SalI restriction site (GTCGAC) in P4, then the PCR product and the pET28a empty vector plasmid are double-digested with BamHI and SalI respectively, and the digested products of the two are Ligation, the ligation product was transformed into E.ColiDH5α, spread on LB plates containing 200 mg / L kana resistance, and cultured at 37°C. After 12 hours, pick a single colony for colony PCR verification, such as Figure 4 , Shake the colony PCR-positive...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a wolfberry phytochelatin synthetase as well as a coding gene and application thereof. Application of the coding gene in preparation of a transgenic plant comprises the following steps of: extracting total RNA in wolfberry leaves, carrying out touchdown PCR, and cloning a wolfberry phytochelatin synthetase gene Lc PCS, so that a 1506bp sequence containing a complete gene coding region is obtained; constructing an escherichia coli expression vector pET28a Lc PCS, and obtaining expression protein by virtue of an escherichia coli heterogeneous expression system; and constructing a binary plant expression vector pCAMBIA2300 LcPCS, transferring the vector into agrobacterium C58 cells by adopting an electroporation method, transforming tobacco with the cells, testing, wherein results show that resistance of transgenic tobacco on salt, heavy metal cadmium and the like is greatly improved, and modifying gene on corn, soybean, rice, peanut, barley, rose, eustoma grandiflorum, euonymus japonicus, robinia ambigua idahoensis and the like, wherein results show that resistance of the transgenic plants to salt and heavy metal cadmium is greatly improved.

Description

technical field [0001] The invention relates to a phytochelatin synthetase in Lycium Chinense Miller and its coding gene and application. Background technique [0002] In a variety of polluted or saline-alkali environments, it contains a variety of excessive plant growth necessary and non-essential metal ions. Under the action of these stress factors, cells produce oxidative stress, producing excessive reactive oxygen species, resulting in damage to cell membrane lipids and nucleic acids. Plants have certain regulatory mechanisms to deal with these adversities, such as producing a large amount of reducing substances (such as glutathione), organic acids (such as malic acid), and antioxidant enzymes. Plant complexation increased by regulating the ratio and content of glutathione (GSH, Glutathione) in the reduced state, or increasing the synthesis or activity of antioxidant enzymes such as regulating the expression of phytochelatin synthetase (PCS, phytochelatinsynthetase) Pr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/10C12N15/54C12N15/82A01H5/00
CPCC12N9/104C12N15/8271C12N15/8273C12Y203/02015
Inventor 季静马志刚王罡
Owner TIANJIN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More