Wolfberry glutamyl cysteine synthetase and encoding gene and application
A wolfberry glutamyl cysteine, encoding gene technology, applied in application, genetic engineering, enzymes and other directions, can solve the problems of large screening workload, long breeding cycle and high cost, and achieves high tolerance to cadmium ions,  The effect of high salt tolerance
- Summary
- Abstract
- Description
- Claims
- Application Information
 AI Technical Summary 
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Cloning of Lycium barbarum glutamylcysteine synthase LcGCS gene
[0030] Using Trizol reagent, total RNA was extracted from 100 mg of fresh Lycium barbarum (Lycium sinensis) leaves, using Transgentransecriptone-stepgDNAremovalandcDNAsynthesissupermix kit, using Lycium barbarum total RNA as template, OligodT 18 As primers, the first strand of cDNA is synthesized under the action of AMV reverse transcriptase.
[0031] According to the Unigene sequence of the Lycium barbarum transcriptome database, the upstream primer LcGCSL-F shown in SEQIDNO.3: 5'GTGACACCCAATTGATTGCTATA3' and the downstream primer LcGCSL-R:5'CTGTTGTGGGGAAAATGTATGTC3' shown in SEQIDNO.4 were designed to amplify the glutamine in Lycium barbarum by PCR. The long fragment of the acylcysteine synthase LcGCS gene, the electropherogram of the PCR product, see figure 1 .(a), after this PCR product is diluted 100 times, carry out the second PCR as a template, the upstream primer of the second nested PCR is b...
Embodiment 2
[0034] Construction process of recombinant vector pMD18-T-LcGCS
[0035] Connect the LcGCS gene shown in SEQ ID NO.2 of the sequence listing with the pMD18-T vector,
[0036] Reaction conditions: 16°C, 30min. The ligation product was transformed into E.ColiTop10. Pick a white colony, and confirm the length of the inserted fragment in the T vector by colony PCR, such as figure 2 , as expected, the vector was sent to BGI for sequencing, and we obtained a 1611bp deoxynucleotide sequence of the gene, which was blasted at NCBI, with high homology to tomato and potato, indicating that the gene was cloned successfully . The LcGCS deoxynucleotide sequence and the pMD18-T sequence were assembled into a cloning vector pMD18-T-LcGCS, such as image 3 shown.
Embodiment 3
[0038] Construction process of E. coli prokaryotic recombinant expression vector pET28a-LcGCS
[0039] Firstly, using pMD18-T-LcGCS plasmid as template, P3 and P4 shown in SEQ ID NO. 7 and SEQ ID NO. 8 are upstream and downstream primers, respectively, to amplify the LcGCS gene. (SEQ ID NO. 7: CGC GGATCC ATGGCCTTGATGTCTCAGGC) (SEQ ID NO. 8: ACGC GTCGAC TCAGTAGAGAAGCTCCTCAAAGAC)
[0040] The reaction conditions are: 94°C, 4min; (94°C, 30Sec; 56°C, 30Sec; 72°C, lmin50Sec) 32cycles; 72°C, 8min.
[0041] There is a BamHI restriction site (GGATCC) in P3 and a SalI restriction site (GTCGAC) in P4, then the PCR product and the pET28a empty vector plasmid were double digested with BamHI and SalI, respectively, and the two restriction products were digested. Ligation, the ligation product was transformed into E.ColiDH5α, spread on LB plate containing 200mg / Lkana resistance, and cultured at 37°C. After 12h, pick a single colony for colony PCR verification, such as Figure 4 , the...
PUM
 Login to View More
 Login to View More Abstract
Description
Claims
Application Information
 Login to View More
 Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
