Unlock instant, AI-driven research and patent intelligence for your innovation.

Wolfberry glutamyl cysteine synthetase and encoding gene and application

A wolfberry glutamyl cysteine, encoding gene technology, applied in application, genetic engineering, enzymes and other directions, can solve the problems of large screening workload, long breeding cycle and high cost, and achieves high tolerance to cadmium ions, The effect of high salt tolerance

Inactive Publication Date: 2016-07-06
TIANJIN UNIV
View PDF5 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, these technologies have problems such as long breeding cycle, radiation hazards, heavy screening workload, and high cost.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Wolfberry glutamyl cysteine synthetase and encoding gene and application
  • Wolfberry glutamyl cysteine synthetase and encoding gene and application
  • Wolfberry glutamyl cysteine synthetase and encoding gene and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Cloning of Lycium barbarum glutamylcysteine ​​synthase LcGCS gene

[0030] Using Trizol reagent, total RNA was extracted from 100 mg of fresh Lycium barbarum (Lycium sinensis) leaves, using Transgentransecriptone-stepgDNAremovalandcDNAsynthesissupermix kit, using Lycium barbarum total RNA as template, OligodT 18 As primers, the first strand of cDNA is synthesized under the action of AMV reverse transcriptase.

[0031] According to the Unigene sequence of the Lycium barbarum transcriptome database, the upstream primer LcGCSL-F shown in SEQIDNO.3: 5'GTGACACCCAATTGATTGCTATA3' and the downstream primer LcGCSL-R:5'CTGTTGTGGGGAAAATGTATGTC3' shown in SEQIDNO.4 were designed to amplify the glutamine in Lycium barbarum by PCR. The long fragment of the acylcysteine ​​synthase LcGCS gene, the electropherogram of the PCR product, see figure 1 .(a), after this PCR product is diluted 100 times, carry out the second PCR as a template, the upstream primer of the second nested PCR is b...

Embodiment 2

[0034] Construction process of recombinant vector pMD18-T-LcGCS

[0035] Connect the LcGCS gene shown in SEQ ID NO.2 of the sequence listing with the pMD18-T vector,

[0036] Reaction conditions: 16°C, 30min. The ligation product was transformed into E.ColiTop10. Pick a white colony, and confirm the length of the inserted fragment in the T vector by colony PCR, such as figure 2 , as expected, the vector was sent to BGI for sequencing, and we obtained a 1611bp deoxynucleotide sequence of the gene, which was blasted at NCBI, with high homology to tomato and potato, indicating that the gene was cloned successfully . The LcGCS deoxynucleotide sequence and the pMD18-T sequence were assembled into a cloning vector pMD18-T-LcGCS, such as image 3 shown.

Embodiment 3

[0038] Construction process of E. coli prokaryotic recombinant expression vector pET28a-LcGCS

[0039] Firstly, using pMD18-T-LcGCS plasmid as template, P3 and P4 shown in SEQ ID NO. 7 and SEQ ID NO. 8 are upstream and downstream primers, respectively, to amplify the LcGCS gene. (SEQ ID NO. 7: CGC GGATCC ATGGCCTTGATGTCTCAGGC) (SEQ ID NO. 8: ACGC GTCGAC TCAGTAGAGAAGCTCCTCAAAGAC)

[0040] The reaction conditions are: 94°C, 4min; (94°C, 30Sec; 56°C, 30Sec; 72°C, lmin50Sec) 32cycles; 72°C, 8min.

[0041] There is a BamHI restriction site (GGATCC) in P3 and a SalI restriction site (GTCGAC) in P4, then the PCR product and the pET28a empty vector plasmid were double digested with BamHI and SalI, respectively, and the two restriction products were digested. Ligation, the ligation product was transformed into E.ColiDH5α, spread on LB plate containing 200mg / Lkana resistance, and cultured at 37°C. After 12h, pick a single colony for colony PCR verification, such as Figure 4 , the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses wolfberry glutamyl cysteine synthetase and an encoding gene and application.The amino acid sequence of wolfberry glutamyl cysteine synthetase is as shown in SEQ ID NO.1.The encoding gene of the wolfberry glutamyl cysteine synthetase is transferred into a target plant, and a transgenic plant high in cadmium ion resistance and high in salt resistance is obtained.

Description

technical field [0001] The invention relates to a γ-glutamyl cysteine ​​synthase (LcGCS) in Lycium barbarum (LyCium Chinense Miller) and its encoding gene and application. Background technique [0002] In the normal growth process of animals and plants, they will not only encounter abiotic stresses such as salinity, heavy metals, drought, cold, and heat, but also biotic stresses such as trauma, insect pests, and viruses. Under these stress conditions, reactive oxygen species will accumulate in the body, resulting in damage to cell contents and cell membrane lipids. Plants have evolved certain regulatory mechanisms to cope with these adversities, such as the production of large amounts of reducing substances and antioxidant enzymes. Animals and plants increase the synthesis of reducing substance glutathione by regulating the expression of glutathione (Glutathione, GSH) synthase such as γ-GCS (Glutamylcys-teine ​​Synthetase). [0003] GSH is a tripeptide composed of glutamic...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/00C12N15/52C12N15/82A01H5/00
CPCC12N9/93C12N15/8271C12N15/8273C12Y603/02002
Inventor 季静马志刚王罡
Owner TIANJIN UNIV