Wolfberry glutathione reductase and encoding gene and application

A technology of glutathione and coding genes, applied in oxidoreductase, application, genetic engineering, etc., can solve the problems of high radiation hazard, heavy screening workload, heavy breeding work, etc., and achieve high tolerance to cadmium ions, The effect of high salt tolerance

Inactive Publication Date: 2016-07-06
TIANJIN UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the breeding cycle is long, the breeding work is heavy, the screening workload is heavy, the radiation hazard is large, and the operation technology requirements are high.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Wolfberry glutathione reductase and encoding gene and application
  • Wolfberry glutathione reductase and encoding gene and application
  • Wolfberry glutathione reductase and encoding gene and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Cloning of Glutathione Reductase LcGR Gene from Lycium barbarum

[0030] Utilize Trizol reagent, extract total RNA from 100mg of fresh Lycium barbarum (Chinese wolfberry) leaves, use Transgentransecriptone-stepgDNAremovalandcDNAsynthesissupermix kit, take Lycium barbarum total RNA as template, OligodT 18 As a primer, the first strand of cDNA was synthesized under the action of AMV reverse transcriptase.

[0031] According to the Unigene sequence design of Lycium barbarum transcriptome database

[0032] The upstream primer LcGRW-F shown in SEQIDNO.3: 5'TGGAAAGCCTACTAAAGCCTGAC3' and the downstream primer LcGRW-R shown in SEQIDNO.4: 5'CAACATTTCTCTATCGGCCCTC3',

[0033] The tail fragment of the glutathione reductase LcGR gene in Lycium barbarum was amplified by PCR, and the electrophoresis of the PCR product is shown in Figure 1(a) after sequencing verification. Tail primer P2 was designed. Design upstream primers according to the Unigene sequence of Lycium barbarum tran...

Embodiment 2

[0039] Construction process of recombinant vector pMD18-T-LcGR

[0040] The LcGR gene shown in the sequence listing was connected to the pMD18-T vector,

[0041] Reaction conditions: 16°C, 30min. The ligation product was transformed into E.ColiTop10. Pick white colonies, colony PCR method to confirm the length of the insert in the T vector, such as figure 2 , as expected, the vector was sent to Huada Gene Company for sequencing, and we obtained the 1609bp deoxynucleotide sequence of the gene, which was blasted at NCBI and showed high homology with tomato, potato, etc., indicating that the gene was cloned successfully . The LcGR deoxynucleotide sequence and the pMD18-T sequence were spliced ​​and assembled into the cloning vector pMD18-T-LcGR, such as image 3 shown

Embodiment 3

[0043] Construction process of prokaryotic recombinant expression vector pET28a-LcGR in Escherichia coli

[0044] First, the pMD18-T-LcGR plasmid was used as a template,

[0045] P3 shown in SEQ ID NO.7 (P3:CGC GGATCC ATGGCTAGGAAGATGTTGATTG),

[0046] P4 shown in SEQ ID NO.8 (P4:ACGC GTC GAC ACTCTCGTCACTCCATTTTCGT) are upstream and downstream primers, respectively, to amplify the LcGR gene. The reaction conditions are: 94°C, 4min; (94°C, 30Sec; 56°C, 30Sec; 72°C, 1min50Sec) 32cycles; 72°C, 8min.

[0047] There is a BamHI restriction site (GGATCC) in P3 and a SalI restriction site (GTCGAC) in P4, then the PCR product and the pET28a empty vector plasmid are double-digested with BamHI and SalI respectively, and the digested products of the two are Ligation, the ligation product was transformed into E.ColiDH5α, spread on LB plates containing 200 mg / L kana resistance, and cultured at 37°C. After 12 hours, pick a single colony for colony PCR verification, such as Figure 4 ,...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses wolfberry glutathione reductase and an encoding gene and application.The amino acid sequence of wolfberry glutathione reductase is as shown in SEQ ID NO.1.The amino acid sequence of the encoding gene of wolfberry glutathione reductase is as shown in SEQ ID NO.2.The encoding gene of wolfberry glutathione reductase is transferred into a target plant, and a transgenic plant high in cadmium ion resistance and high in salt resistance is obtained.

Description

technical field [0001] The invention relates to a glutathione reductase in Lycium Chinense Miller and its encoding gene and application. Background technique [0002] During normal growth, animals and plants encounter not only abiotic stresses such as salinity, heavy metals, drought, cold, and heat, but also biotic stresses such as trauma, insect pests, and viruses. Under these stress conditions, reactive oxygen species will accumulate in the body, resulting in damage to cell membrane lipids. Plants have evolved certain regulatory mechanisms to cope with these adversities, such as the production of large amounts of reducing substances and antioxidant enzymes. Animals and plants increase the ratio or content of the reducing substance glutathione (GSH) by regulating the expression of enzymes in the redox state of glutathione (Glutathione) such as GR (Glutathione reductase). [0003] GSH is a tripeptide composed of glutamic acid, cysteine ​​and glycine, which is divided into ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/02C12N15/53C12N15/82A01H5/00
CPCC12N9/0051C12N15/8271C12N15/8273C12Y108/01007
Inventor季静马志刚王罡
OwnerTIANJIN UNIV