LAMP primer combination for detecting three ophthalmic infection spirochetes and application
A primer combination and primer set technology, applied in the direction of microorganism-based methods, microorganisms, recombinant DNA technology, etc., can solve the problems of easy contamination, long PCR detection time, high false positive rate, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0138] Embodiment 1, primer design and preparation
[0139] Several primers for identifying Treponema pallidum, Borrelia burgdorferi and Leptospira were obtained through a large number of sequence analysis and alignment. Preliminary experiments were performed on each primer to compare their sensitivity and specificity, and finally three sets of LAMP primer sets for identifying Treponema pallidum, Borrelia burgdorferi and Leptospira were obtained.
[0140] Primer set for identifying Treponema pallidum, including 2 outer primers (F3-1, B3-1), 2 inner primers (FIP-1, BIP-1) and 2 loop primers (LF-1, LB-1 ), each primer sequence is as follows (5'→3'):
[0141] F3-1 (Sequence 1 of the Sequence Listing): CTTTTGCCTATCCTAGCCG;
[0142] B3-1 (sequence 2 of the sequence listing): GCGGTAAATGTAATTCTTGAGG;
[0143] FIP-1 (SEQ ID NO: 3 of the SEQUENCE LISTING): TCTGAAAAAGATCGAGTGAGCTGACGTATGGAAGAAGTGGGGAAA;
[0144] BIP-1 (SEQ ID NO: 4 of the SEQUENCE LISTING): ATCCAGCAGTACGAGCACTGTCTGC...
Embodiment 2
[0165] Embodiment 2, detection method establishment
[0166] 1. Extract the genomic DNA of the spirochete to be tested or extract the total DNA of the biological sample to be tested.
[0167] 2. Take the DNA obtained in step 1 as a template, and use the primer set I prepared in Example 1 to perform LAMP amplification.
[0168] Reaction system for LAMP amplification: 1μL 10×ThermoPol Buffer, 1.6μL 5M betaine, 0.1μL 50mg / ml BSA, 0.4μL 100mM MgSO 4 , 0.3 μL 20×EvaGreen, 0.15 μL 100 mM dNTPs, 0.4 μL 8U / ml Bst DNA polymerase large fragment, 1 μL primer mix (F3-1, B3-1, FIP-1, BIP-1, LF-1 and LB-1 mixture), 2ng template DNA, with ddH 2O to make up to 10 μL. The concentration of each primer in the reaction system is as follows: 0.5 μM F3-1, 0.5 μM MB3-1, 2 μM FIP-1, 2 μM BIP-1, 1 μM LF-1, 1 μM LB-1.
[0169] Reaction program for LAMP amplification: constant temperature at 65°C for 50min. During the reaction process, the fluorescent signal was detected by a fluorescent PCR in...
Embodiment 3
[0178] Embodiment 3, reference plasmid construction
[0179] Treponema pallidum reference plasmid: insert the double-stranded DNA molecule shown in sequence 19 of the sequence listing between the ApaI and SacI restriction sites of the pGEM-T EasyVector vector to obtain the reference plasmid.
[0180] Borrelia burgdorferi reference plasmid: Insert the double-stranded DNA molecule shown in sequence 20 of the sequence listing between the ApaI and SacI restriction sites of the pGEM-TEasy Vector vector to obtain the reference plasmid.
[0181] Leptospira reference plasmid: Insert the double-stranded DNA molecule shown in Sequence 21 of the sequence listing between the ApaI and SacI restriction sites of the pGEM-T EasyVector vector to obtain the reference plasmid.
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap