Unlock instant, AI-driven research and patent intelligence for your innovation.

LAMP primer combination for detecting three ophthalmic infection spirochetes and application

A primer combination and primer set technology, applied in the direction of microorganism-based methods, microorganisms, recombinant DNA technology, etc., can solve the problems of easy contamination, long PCR detection time, high false positive rate, etc.

Active Publication Date: 2016-08-17
智德科技(无锡)有限公司
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, PCR has the disadvantages of long detection time, easy contamination, and high false positive rate, which limits its application.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • LAMP primer combination for detecting three ophthalmic infection spirochetes and application
  • LAMP primer combination for detecting three ophthalmic infection spirochetes and application
  • LAMP primer combination for detecting three ophthalmic infection spirochetes and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0138] Embodiment 1, primer design and preparation

[0139] Several primers for identifying Treponema pallidum, Borrelia burgdorferi and Leptospira were obtained through a large number of sequence analysis and alignment. Preliminary experiments were performed on each primer to compare their sensitivity and specificity, and finally three sets of LAMP primer sets for identifying Treponema pallidum, Borrelia burgdorferi and Leptospira were obtained.

[0140] Primer set for identifying Treponema pallidum, including 2 outer primers (F3-1, B3-1), 2 inner primers (FIP-1, BIP-1) and 2 loop primers (LF-1, LB-1 ), each primer sequence is as follows (5'→3'):

[0141] F3-1 (Sequence 1 of the Sequence Listing): CTTTTGCCTATCCTAGCCG;

[0142] B3-1 (sequence 2 of the sequence listing): GCGGTAAATGTAATTCTTGAGG;

[0143] FIP-1 (SEQ ID NO: 3 of the SEQUENCE LISTING): TCTGAAAAAGATCGAGTGAGCTGACGTATGGAAGAAGTGGGGAAA;

[0144] BIP-1 (SEQ ID NO: 4 of the SEQUENCE LISTING): ATCCAGCAGTACGAGCACTGTCTGC...

Embodiment 2

[0165] Embodiment 2, detection method establishment

[0166] 1. Extract the genomic DNA of the spirochete to be tested or extract the total DNA of the biological sample to be tested.

[0167] 2. Take the DNA obtained in step 1 as a template, and use the primer set I prepared in Example 1 to perform LAMP amplification.

[0168] Reaction system for LAMP amplification: 1μL 10×ThermoPol Buffer, 1.6μL 5M betaine, 0.1μL 50mg / ml BSA, 0.4μL 100mM MgSO 4 , 0.3 μL 20×EvaGreen, 0.15 μL 100 mM dNTPs, 0.4 μL 8U / ml Bst DNA polymerase large fragment, 1 μL primer mix (F3-1, B3-1, FIP-1, BIP-1, LF-1 and LB-1 mixture), 2ng template DNA, with ddH 2O to make up to 10 μL. The concentration of each primer in the reaction system is as follows: 0.5 μM F3-1, 0.5 μM MB3-1, 2 μM FIP-1, 2 μM BIP-1, 1 μM LF-1, 1 μM LB-1.

[0169] Reaction program for LAMP amplification: constant temperature at 65°C for 50min. During the reaction process, the fluorescent signal was detected by a fluorescent PCR instru...

Embodiment 3

[0178] Embodiment 3, reference plasmid construction

[0179] Treponema pallidum reference plasmid: insert the double-stranded DNA molecule shown in sequence 19 of the sequence listing between the ApaI and SacI restriction sites of the pGEM-T EasyVector vector to obtain the reference plasmid.

[0180] Borrelia burgdorferi reference plasmid: Insert the double-stranded DNA molecule shown in sequence 20 of the sequence listing between the ApaI and SacI restriction sites of the pGEM-TEasy Vector vector to obtain the reference plasmid.

[0181] Leptospira reference plasmid: Insert the double-stranded DNA molecule shown in Sequence 21 of the sequence listing between the ApaI and SacI restriction sites of the pGEM-T EasyVector vector to obtain the reference plasmid.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an LAMP primer combination for detecting three ophthalmic infection spirochetes and application. The primer combination is composed of eighteen single-stranded DNA molecules shown from the sequence 1 to the sequence 18. The invention further provides application of the primer combination. The invention furthermore provides a method of using the primer combination for identifying whether a spirochete to be detected is treponema pallidum, or borrelia burgdorferi or leptospira, a method for identifying whether the spirochete to be detected is treponema pallidum, or borrelia burgdorferi or leptospira and a method for identifying whether a sample to be detected is infected by treponema pallidum and / or borrelia burgdorferi and / or leptospira. Treponema pallidum, borrelia burgdorferi and leptospira can be fast and accurately detected by using the method.

Description

technical field [0001] The invention relates to a combination and application of LAMP primers for detecting three kinds of ophthalmic infection spirochetes. Background technique [0002] Treponema pallidum is the pathogen that causes syphilis, which can invade various systems and organs of the host body, can cause abortion in pregnant women, and can also cause stillbirth and congenital syphilis through the placenta. Treponema pallidum is extremely aggressive and can destroy the integrity of the patient's epidermal or mucosal barrier, increasing the risk of HIV infection or transmission in patients with syphilis by 4-5 times, and promoting HIV infection and transmission. Statistics from the World Health Organization in 2010 show that there are more than 12 million new cases of syphilis each year worldwide. As of 2009, data from the China Disease Prevention and Control Information System showed that 31 provinces and municipalities in mainland China had reported as many as 358...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/04C12N15/11C12R1/01
CPCC12Q1/6844C12Q1/689C12Q2531/119C12Q2563/107Y02A50/30
Inventor 陶勇
Owner 智德科技(无锡)有限公司