Chimeric antigen receptor, gene and recombinant expression vector thereof, CARMSLN-NKT cell and preparation method and application thereof
A chimeric antigen receptor and NKT cell technology, applied in the field of tumor biological products, can solve the problems of insufficient distribution of MSLN monoclonal antibody and transient targeting effect of MSLN monoclonal antibody, achieve good industrial application prospects and enhance specific killing Active, power-enhancing effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0027] There is no particular limitation on the preparation method of the lentiviral expression vector pWPXL-MSLNScFv-CD8-CD137-CD3ζ, which can be various methods conceivable by those skilled in the art. Preferably, the lentiviral expression vector pWPXL-MSLNScFv-CD8-CD137 -The preparation method of CD3ζ comprises the following steps:
[0028] (1) The hinge region and transmembrane region of CD8, the intracellular signaling domain of CD137 and the intracellular signaling domain of CD3ζ were respectively amplified from NKT cell cDNA, and cloned into the vector pWPXL-GFP to construct pWPXL-CD8 - CD137-CD3ζ;
[0029] (2) The nucleotide sequences encoding rat growth hormone signal peptide and MSLNScFv were synthesized and cloned into pWPXL-CD8-CD137-CD3ζ, and the correct sequence of pWPXL-MSLNScFv-CD8-CD137-CD3ζ was obtained after sequencing verification.
[0030] In step (1), there is no particular limitation on the methods for respectively amplifying the hinge region and transm...
Embodiment 1
[0082] Example 1 Preparation of NKT cells
[0083] (1) Take human venous blood in a vacuum tube containing heparin. Mononuclear cells (PBMCs) were obtained by density gradient centrifugation using lymphocyte separation medium.
[0084] (2) After PBMCs were washed three times, the final concentration of cells was adjusted to 2×10 by using NKT cell culture medium GT-T551 containing 0.6 volume % human autologous serum. 6 cells / mL; the cells were inoculated on a 75 cm 2 in cell culture flasks. Then add recombinant human interleukin-2 with a final concentration of 500U / mL, 50ng / ml CD3 monoclonal antibody and 50ng / mL recombinant human interleukin-15 to the culture medium, at 37°C and saturated humidity of 5% CO 2 cultured in an incubator.
[0085] (3) On the 4th day of culture, transfer the cells to an uncoated culture flask, add NKT cell culture medium GT-T551 every 2 days according to the number of cell growth, and control the cell concentration to 1×10 8 cells / mL, and added ...
Embodiment 2
[0086] Example 2 Construction of lentiviral expression vector pWPXL-MSLNScFv-CD8-CD137-CD3ζ
[0087] (1) Preparation of NKT cell cDNA
[0088] The NKT cells cultured in Example 1 were centrifuged to precipitate, and the total RNA of the cells was extracted with the total RNA extraction kit RNAisoReagent, and stored at -80°C for future use. Extracted total RNA with RevertAid Reverse Transcription Kit TM NKT cell cDNA was reverse transcribed with First Strand cDNA Synthesis Kit and stored at -20°C for future use.
[0089] (2) Preparation of lentiviral plasmid pWPXL-CD8-CD137-CD3ζ
[0090] The following primer sequences were designed and synthesized (wherein, the underline marks are protected bases, and the square boxes are enzyme cleavage sites):
[0091] P1 (SEQ ID NO.11): GATC CTGAGCAACTCCATCATGTACTTC
[0092] MluI
[0093] P2 (SEQ ID NO.12): GATC GCAGTAAAGGGTGATAACCAGTGA
[0094] BglII
[0095] P3 (SEQ ID NO.13): GATC AAACGGGGCAGAAAGAAACTCC
[0096] BglII ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com