CRISPR (clustered regularly interspaced short palindromic repeats)-Cas9-system-based Saccharomyces cerevisiae genome concurrent multiplex edition vector and application thereof

A Saccharomyces cerevisiae and genome technology, applied in the field of Saccharomyces cerevisiae genome parallel multiple editing vectors, can solve the problems of long experimental cycle, time-consuming, cumbersome editing system construction, etc., and achieve the effect of simple operation and simple multi-gene editing work

Pending Publication Date: 2016-12-07
SUZHOU HONGXUN BIOTECH CO LTD
View PDF4 Cites 45 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Traditional genome editing technology uses homologous recombination mechanism (homologous recombination) to edit genes in a targeted manner, which can help researchers clarify the function of genes. Traditional genome editing technology uses long fragments of DNA as target sites, and the "positioning system" must also It is a long DNA fragment, the construction of the editing system is complex and time-consuming, the experiment cycle is long, the efficiency is very low, and the gene is easy to mutate and other defects
The second-generation genome editing technology (including ZFN system and TALEN system) has solved the problem of low specificity of the editing system to a certain extent, but still failed to solve the outstanding problems of cumbersome and time-consuming construction of the editing system
[0013] The existing CRISPR-Cas9 system consists of two plasmids, one of which expresses the Cas9 protein with the activity of cutting double-stranded DNA. If three genes are to be edited, the other three plasmids are required to express three sgRNAs. These four Plasmids require four different screening markers, and the compatibility of plasmids must also be considered. The construction of such a genome editing system is very difficult and cumbersome, which greatly prolongs the experimental cycle

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • CRISPR (clustered regularly interspaced short palindromic repeats)-Cas9-system-based Saccharomyces cerevisiae genome concurrent multiplex edition vector and application thereof
  • CRISPR (clustered regularly interspaced short palindromic repeats)-Cas9-system-based Saccharomyces cerevisiae genome concurrent multiplex edition vector and application thereof
  • CRISPR (clustered regularly interspaced short palindromic repeats)-Cas9-system-based Saccharomyces cerevisiae genome concurrent multiplex edition vector and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] 1. Design the following sequence based on the known sequence:

[0059] 1) Yeast Cas9 protein expression cassette (TEF1promoter-Cas9-CYC1terminitor), including TEF1 promoter, Cas9 protein, CYC1 terminator, the sequence is shown in SEQ ID NO.1, wherein: CGAACGCCATCGACTTACCAGTATGCTACTTACTAT and CAGCAGGAGCTGGACTCTACTGATGTCTGGACAGC at the beginning and end of the sequence of SEQ ID NO.1 are Cas9 protein expression cassette and pSynoYACO vector homology arm sequence; ggcgcgcc and ggcgcgcc are AscI restriction site sequences, GTTTAAAC is PmeI restriction site.

[0060] 2) The sequence of sgRNA scaffold expression box 1 (SNR52 promoter+sgRNA Scaffold+SUP4terminitor) is shown in SEQ ID NO.2, wherein: GGACGCTCGAAGGCTTTAATTTGC and gctgctaacaaagcccgaaag at the beginning and end of the sequence of SEQ ID NO.2 are sgRNA Scaffold expression box 1 and pSynoYACO-Cas9 vector The source arm sequence, GTTTAAAC is the sequence of the restriction site of PmeI.

[0061] 3) The sequence of sg...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a CRISPR (clustered regularly interspaced short palindromic repeats)-Cas9-system-based Saccharomyces cerevisiae genome concurrent multiplex edition vector and application thereof. Cas9 protein expression cassettes and a plurality of sgRNA (small guide ribonucleic acid) scaffold expression cassettes are integrated into the vector to obtain a vector-Cas9-sgRNA scaffold, and a plurality of sgRNA segments designed and synthesized by using ADE1 as a target are integrated into the vector-Cas9-sgRNA scaffold, thereby obtaining the Saccharomyces cerevisiae genome concurrent multiplex edition vector. By adopting a simple substance granule single-copy vector system, one plasmid is utilized to simultaneously express the Cas9 protein and three sgRNA scaffolds, so that three target genes can be edited simultaneously; and thus, the multigene edition operation is very simple. Besides, the target gene edition system only needs one-step component and conversion, and thus, is simple to operate.

Description

technical field [0001] The invention relates to a Saccharomyces cerevisiae genome parallel multiple editing vector based on a CRISPR-Cas9 system and an application thereof. Background technique [0002] With the completion of human genome sequencing, life science research has entered a post-genome era aimed at revealing gene functions, and genome editing technology has become an important research tool and means. Traditional genome editing technology uses homologous recombination mechanism (homologous recombination) to edit genes in a targeted manner, which can help researchers clarify the function of genes. Traditional genome editing technology uses long fragments of DNA as target sites, and the "positioning system" must also It is a long DNA fragment, the construction of the editing system is complex and time-consuming, the experiment cycle is long, the efficiency is very low, and the gene is prone to mutation and other defects. The second-generation genome editing techno...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/81C12N15/66C12N1/19C12R1/865
CPCC12N15/66C12N15/81C12N2800/102C12N2800/80C12N2810/10C12N1/185C12R2001/865
Inventor季广建钟云鹏蔡晓辉李彦敏杨平
OwnerSUZHOU HONGXUN BIOTECH CO LTD