Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Kit for detecting lung cancer susceptibility genes

A technology of susceptibility genes and kits, which is applied in the field of kits for detection of lung cancer susceptibility genes, can solve problems such as linkage disequilibrium and poor independence of related genes, and achieve the effects of reducing morbidity, avoiding cross-infection, and improving survival

Inactive Publication Date: 2016-12-07
GUANGZHOU TOPGENE TECH CO LTD
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The defect of the above technical solution is that the independence of the related genes is poor and there is linkage disequilibrium

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for detecting lung cancer susceptibility genes
  • Kit for detecting lung cancer susceptibility genes
  • Kit for detecting lung cancer susceptibility genes

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0055] This embodiment provides a kit for detecting lung cancer susceptibility genes, which includes: a PCR reaction system, a PCR product purification system, and a sequencing reaction system.

[0056] Wherein, the PCR reaction system includes the following primers:

[0057] (1) Primers for the single nucleotide polymorphism site rs9387478 (C→A) on the DCBLD1 gene:

[0058] rs9387478 upstream primer: GGCAGAAAGGAAACAGTTGT (SEQ ID NO: 7);

[0059] rs9387478 downstream primer: ATGTTGGGAATTGTTGAGAC (SEQ ID NO: 8);

[0060] (2) Primers for the single nucleotide polymorphism site rs753955 (A→G) on the MIPEP gene:

[0061] rs753955 upstream primer: GCACCACACATTCTTAGGAC (SEQ ID NO: 9);

[0062] rs753955 downstream primer: TTATGGAGGCTGGCAAGTC (SEQ ID NO: 10);

[0063] (3) Primers for the single nucleotide polymorphism site rs36600 (T→C) on the MTMR3 gene:

[0064] rs36600 upstream primer: GTAGAATTGTTGGATCATAGG (SEQ ID NO: 11);

[0065] rs36600 downstream primer: GAGATGCCACTGAATT...

Embodiment 2

[0095] The difference between this example and Example 1 is that the PCR reaction system includes the following primers,

[0096] (1) Primers for the single nucleotide polymorphism site rs2285947 (G→A) on the DNAH11 gene:

[0097] rs2285947 upstream primer: AGTATGATGAGTTTGGAGCA (SEQ ID NO: 1);

[0098] rs2285947 downstream primer: GGAAATAAGCCAAACTGAGA (SEQ ID NO: 2);

[0099] (2) Primers targeting the single nucleotide polymorphism site rs2494938 (G→A) on the LRFN2 gene.

[0100] rs2494938 upstream primer: ACTAAGCCTCAGTCAAGGTTTG (SEQ ID NO: 3);

[0101] rs2494938 downstream primer: TAGCGAGGCATTTGGAACAG (SEQ ID NO: 4);

[0102] (3) Primers for the single nucleotide polymorphism site rs4488809 (T→C) on the TP63 gene:

[0103] s4488809 upstream primer: GGGAAGGTAGAATATATGAGT (SEQ ID NO: 5);

[0104] rs4488809 downstream primer: AAGCCCTCTCAATATCTG (SEQ ID NO: 6);

[0105] (4) Primers for the single nucleotide polymorphism site rs9387478 (C→A) on the DCBLD1 gene:

[0106] rs9...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a kit for detecting lung cancer susceptibility genes. The kit comprises a primer aiming at a single nucleotide polymorphism site rs4488809 (T-C) on a TP63 gene, a primer aiming at a single nucleotide polymorphism site rs36600 (T-C) on an MTMR3 gene, and a primer aiming at a single nucleotide polymorphism site rs2395185 (G-T) on an HLA gene.

Description

technical field [0001] The invention relates to a kit for detecting susceptibility genes of lung cancer. Background technique [0002] Lung cancer is one of the malignant tumors with the fastest increasing morbidity and mortality and the greatest threat to the health and life of the population. In the past 50 years, many countries have reported that the morbidity and mortality of lung cancer have increased significantly. The incidence and mortality of lung cancer in men rank first among all malignant tumors, and the incidence and mortality of lung cancer occupy the second place in women. [0003] Gene sequencing is a new type of genetic testing technology, which can analyze and determine the full sequence of genes from blood or saliva, and predict the possibility of suffering from various diseases, so as to achieve early prevention and treatment. [0004] Chinese patent application 201210021993.1 provides a non-invasive detection kit for detecting small cell lung cancer sus...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
Inventor 由晓斌兰兆吉
Owner GUANGZHOU TOPGENE TECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com