Method for gene point mutation restoration

A gene editing, target gene technology, applied in genetic engineering, biochemical equipment and methods, nucleic acid vectors, etc., can solve problems such as inability to cut, achieve the effect of improving efficiency, fine gene editing, and avoiding genome instability

Inactive Publication Date: 2017-01-04
上海澜西亚基因科技有限公司
View PDF2 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The cleavage of the genome by nucleases such as Cas9 requires the guidance of sgRNA. When the length of sgRNA is 20-21bp, Cas9 can recognize and cut the target site, thereby leaving a DSBs gap at the target site; when the length of sgRNA is 14-15bp , Cas9 can recognize and bind the target site, but cannot cleave it

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for gene point mutation restoration
  • Method for gene point mutation restoration
  • Method for gene point mutation restoration

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] Embodiment 1 GFP reporter gene transformation, restore the expression of GFP green fluorescent protein

[0055] 1) Transform ssgRNA to obtain ssgRNA with specific RNA hairpin structure

[0056] A unique RNA hairpin such as MS2 / PP7 is inserted at a specific site of ssgRNA (SpCas9 and SaCas9), and this type of hairpin structure can be specifically recognized by MS2 binding protein / PCP protein.

[0057] The full sequence of ssgRNA with PP7 hairpin structure is:

[0058] ccggtgagaccgagagagggtctcagttttagagctagcgagggagcagacgatatggcgtcgctccctcgttagcaagttaaaataaggctagtccgttatcaacttgcgaggggagcagacgatatggcgtcgctccctcgtaagtggcaccgagtcggtgctttttgaattc

[0059] The full sequence of ssgRNA with MS2 hairpin structure is:

[0060] ccggtgagaccgagagagggtctcagttttagagctaggccaacatgaggatcacccatgtctgcagggcctagcaagttaaaataaggctagtccgttatcaacttggccaacatgaggatcacccatgtctgcagggccaagtggcaccgagtcggtgctttttttt

[0061] All the above ssgRNA sequences were synthesized in Nanjing GenScript Biotechn...

Embodiment 2

[0081] Experimental design of embodiment 2 human TP53 gene point mutation repair

[0082] 1) The U-251 human glioma cell line was selected, and the sequencing results showed that the TP53 gene of this cell line carried a homozygous point mutation of R273H (CGT->CAT). To repair the point mutation, sgRNA (SaCas9) specifically targeting the TP53 gene was designed near this site ( Figure 6 ).

[0083] Its specific sequence:

[0084] agagaccggcgcacagaggaa

[0085] PAM: gagaat

[0086] 2) Designing a repair template: a DNA single oligonucleotide chain is selected as the template, and the sequence is actgggacggaacagctttgaggtgcgtgtttgtgcctgtcctgggcgtgataggcgaacggaagaggaaaacctccgcaagaaaggggagcctcaccacgagctgcccccaggggag. A synonymous mutation was introduced at the sgRNA recognition site of TP53 to avoid insertion / deletion mutations at the repaired site being cut by SaCas9.

[0087] 3) Transfect U251 cell line to verify mutation repair efficiency: In the experimental group, the SaC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to an efficient and precise gene point mutation restoration gene editing method. Different fixed point cutting capability on the genome DNA (deoxyribonucleic acid) during the combination of nuclease with sgRNA with different lengths is used, the targeting transcriptional control factor is used in an auxiliary way; the homologous recombination reaction efficiency is obviously improved; the gene mutation accurate restoration can be accurately and efficiently performed, or exogenous genes can be guided into a targeted gene. The invention also discloses a gene editing composition, an RNA (ribonucleic acid) aptamer sequence and ssgRNA coupling molecule, and a purpose used for gene editing.

Description

technical field [0001] The invention relates to the field of molecular biology gene editing. Specifically, the present invention is used to perform site-directed repair of gene mutations and knock-in of exogenous genes in mammalian cells by means of gene editing. Background technique [0002] At present, the basic principle of site-specific genome editing / modification is to use the spontaneous or induced DNA double-strand breaks (double-strain breaks, DSBs) in the target site region, DSBs will activate the DNA repair mechanism in the cell to carry out genome modification, such as non- Homologous end joining (Non-homologous end joint, NHEJ) or homologous recombination (Homologous recombination, HR) (attachment figure 1 ). [0003] In mammalian cells, the probability of spontaneous generation of DSB is about 1 / 10 4 , if nucleases such as spCas9 and SaCas9 are used to induce DSBs through genetic engineering methods, the efficiency can be increased to more than 10%, and it ha...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/85C12N15/113
CPCC12N15/00C12N15/113C12N15/85C12N2310/10C12N2800/107C12N2800/80C12N2810/10C12N2830/002C12N2830/005
Inventor 程田林仇子龙
Owner 上海澜西亚基因科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap