Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

FUT8 gene knockout method based on CRISPR technology

A gene knockout and gene technology, which is applied in the field of knocking out the FUT8 gene based on CRISPR technology to improve the ADCC activity of antibodies, can solve the problems of low action efficiency, restriction of identifiable sequences, complicated and time-consuming coding process, etc.

Inactive Publication Date: 2017-02-15
SHANGHAI WUXI BIOLOGIC TECH CO LTD +1
View PDF3 Cites 38 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Such artificial nuclease technology often has the disadvantages of limited recognizable sequences, complicated and time-consuming coding process, and low efficiency.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • FUT8 gene knockout method based on CRISPR technology
  • FUT8 gene knockout method based on CRISPR technology
  • FUT8 gene knockout method based on CRISPR technology

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0034] In order to have a more specific understanding of the technical content, characteristics and effects of the present invention, now in conjunction with the accompanying drawings, the details are as follows:

[0035] The method for knocking out the FUT8 gene based on CRISPR technology of the present embodiment comprises the following steps:

[0036] Step 1, for the sequence of the FUT8 gene, design the sgRNA sequence that guides the cleavage of the CAS9 endonuclease.

[0037] Among them, the sgRNA sequence includes:

[0038] ggatcaagtatttgacaaactgg (SEQ ID NO: 1)

[0039] gtcagacgcactgacaaagtggg (SEQ ID NO:2)

[0040] Step 2, recombining the sgRNA sequence described in step 1 into the gene knockout vector px330 (hereinafter referred to as the first vector) to obtain a vector co-expressing the sgRNA and the endonuclease (hereinafter referred to as the second vector).

[0041] Specifically include the following steps:

[0042] 1) Synthesize primers encoding the targetin...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a FUT8 gene knockout method based on a CRISPR technology. The FUT8 gene knockout method comprises: 1) designing a sgRNA sequence; 2) recombining the sgRNA sequence into a first vector to obtain a second vector; 3) transfecting the second vector into cells, and extracting DNA; 4) carrying out PCR amplification; 5) carrying out denaturation and annealing on the PCR product to form a heterologous hybrid double-stranded DNA; 6) cutting the heterologous hybrid double-stranded DNA, and analyzing the product to obtain the NHEJ occurring proportion in each cell population; and 7) selecting the cell population having the high NHEJ occurring proportion, carrying out limiting dilution method cloning, screening the monoclonal cell, and carrying out expanded culture to obtain the FUT8 gene knockout antibody. The invention further discloses the sgRNA sequence for the method. According to the present invention, the sgRNA capable of recognizing the FUT8 gene specific sequence is encoded, and the sgRNA and the sequence encoding the endonuclease are transfected into the cells, such that the FUT8 gene inactivation purpose is achieved, and the activity of the antibody ADCC is improved.

Description

technical field [0001] The invention relates to the field of biology, in particular to a method for knocking out the FUT8 gene based on CRISPR technology to improve the ADCC activity of antibodies. Background technique [0002] ADCC (antibody dependent cellular cytotoxicity, antibody-dependent cell-mediated cytotoxicity) refers to a series of immune responses triggered by NK (natural killer) cells. NK cells bind to the constant region (Fc) of antibody molecules through FcγRIII receptors, Cellular degradation and apoptosis are then induced on the target cell surface by perforin and granzymes. However, the interaction between the constant region of the antibody molecule and the FcγRIII receptor is very sensitive to the glycosylation level of the constant region of the antibody molecule, and the antibody constant region without glycosylation or the antibody constant region with excessive glycosylation Neither can normally bind to FcγRIII receptors. Among them, the more import...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/85
Inventor 邱沛然蔡洁行周伟昌陈智胜
Owner SHANGHAI WUXI BIOLOGIC TECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com