FUT8 gene knockout method based on CRISPR technology
A gene knockout and gene technology, which is applied in the field of knocking out the FUT8 gene based on CRISPR technology to improve the ADCC activity of antibodies, can solve the problems of low action efficiency, restriction of identifiable sequences, complicated and time-consuming coding process, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0034] In order to have a more specific understanding of the technical content, characteristics and effects of the present invention, now in conjunction with the accompanying drawings, the details are as follows:
[0035] The method for knocking out the FUT8 gene based on CRISPR technology of the present embodiment comprises the following steps:
[0036] Step 1, for the sequence of the FUT8 gene, design the sgRNA sequence that guides the cleavage of the CAS9 endonuclease.
[0037] Among them, the sgRNA sequence includes:
[0038] ggatcaagtatttgacaaactgg (SEQ ID NO: 1)
[0039] gtcagacgcactgacaaagtggg (SEQ ID NO:2)
[0040] Step 2, recombining the sgRNA sequence described in step 1 into the gene knockout vector px330 (hereinafter referred to as the first vector) to obtain a vector co-expressing the sgRNA and the endonuclease (hereinafter referred to as the second vector).
[0041] Specifically include the following steps:
[0042] 1) Synthesize primers encoding the targetin...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com