MC1R (melanocortin 1 receptor) gene carrier and construction method thereof
A technology of gene carrier and construction method, which is applied in the field of MC1R gene carrier and its construction, can solve the problem of unclear molecular mechanism of melanin deposition, and achieve the effect of simple and fast method
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0031] In order to make the object, technical solution and advantages of the present invention more clear, the present invention will be further described in detail below in conjunction with the examples. It should be understood that the specific embodiments described here are only used to explain the present invention, not to limit the present invention.
[0032] The application principle of the present invention will be described in detail below in conjunction with the accompanying drawings.
[0033] The MC1R gene carrier of the embodiment of the present invention includes MC1R-neo and MC1R-GFP; the nucleotide sequence of the MC1R-neo is SEQ ID NO:1; the nucleotide sequence of the MC1R-GFP is SEQ ID NO:2.
[0034] SEQ ID NO: 1 is:
[0035] TGGCTTTATATCTTGTGGAAAGGACGAAACACCGAAGGAGAGGGAGGACACGAGTTTTTAGAGCTAGAA;
[0036] SEQ ID NO: 2 is:
[0037] TGGCTTTATATCTTGTGGAAAGGACGAAACACCGCTTCCTGGGGGTCATCGCCGGTTTTAGAGCTAGA.
[0038] Such as figure 1 As shown, the construction metho...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


