Check patentability & draft patents in minutes with Patsnap Eureka AI!

MC1R (melanocortin 1 receptor) gene carrier and construction method thereof

A technology of gene carrier and construction method, which is applied in the field of MC1R gene carrier and its construction, can solve the problem of unclear molecular mechanism of melanin deposition, and achieve the effect of simple and fast method

Inactive Publication Date: 2017-05-10
ANHUI UNIVERSITY
View PDF1 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, in birds, the molecular mechanism of MC1R affecting melanin deposition is still unclear. In terms of its gene function, there are no reports on the knockout of MC1R gene and its effect on feather color traits.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • MC1R (melanocortin 1 receptor) gene carrier and construction method thereof
  • MC1R (melanocortin 1 receptor) gene carrier and construction method thereof
  • MC1R (melanocortin 1 receptor) gene carrier and construction method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0031] In order to make the object, technical solution and advantages of the present invention more clear, the present invention will be further described in detail below in conjunction with the examples. It should be understood that the specific embodiments described here are only used to explain the present invention, not to limit the present invention.

[0032] The application principle of the present invention will be described in detail below in conjunction with the accompanying drawings.

[0033] The MC1R gene carrier of the embodiment of the present invention includes MC1R-neo and MC1R-GFP; the nucleotide sequence of the MC1R-neo is SEQ ID NO:1; the nucleotide sequence of the MC1R-GFP is SEQ ID NO:2.

[0034] SEQ ID NO: 1 is:

[0035] TGGCTTTATATCTTGTGGAAAGGACGAAACACCGAAGGAGAGGGAGGACACGAGTTTTTAGAGCTAGAA;

[0036] SEQ ID NO: 2 is:

[0037] TGGCTTTATATCTTGTGGAAAGGACGAAACACCGCTTCCTGGGGGTCATCGCCGGTTTTAGAGCTAGA.

[0038] Such as figure 1 As shown, the construction metho...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an MCIR (MelanoCortin 1 Receptor) gene carrier and a construction method thereof. The MCIR gene carrier comprises MC1R-neo and MC1R-GFP (Green Fluorescent Protein), wherein the nucleotide sequence of the MC1R-neo is SEQ ID NO:1, and the nucleotide sequence of the MC1R-GFP is SEQ ID NO:2. A CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) / Cas9 system is adopted to construct an MC1R gene knock-out vector, and only a sgRNA (Ribonucleic Acid) of which the length is about 20bp needs to be designed by aiming at a gene knock-out point to be connected with a universal Cas9 gene. Therefore, compared with traditional gene knock-out technologies including ZFNs (Zinc finger nuclease), TALENs (Transcription Activator-Like Effector Nucleases) and the like, the construction method disclosed by the invention adopting the CRISPR / Cas9 to construct the gene knock-out vector is simpler and more convenient and is more convenient to be further popularized and applied to subsequent experiments.

Description

technical field [0001] The invention belongs to the technical field of gene carriers, and in particular relates to an MClR gene carrier and a construction method thereof. Background technique [0002] As an important economic trait, the coat or plumage color of animals plays an important role in determining the purity and kinship of breeds. Studies have found that the different fur or feather colors of animals are caused by the different types and distributions of melanin. Melanocortin 1 receptor (MC1R), the main gene controlling the formation of animal melanin, consists of one exon, expressed in melanocytes, and interacts with the natural ligand a-MSH, through G The protein-coupled cAMP signaling pathway regulates a series of cascade reactions in melanocytes, and finally synthesizes their respective derivatives, pheomelanocytes and eumelanin, through dopa or dopachrome, thereby determining the coat color of animals. However, the molecular mechanism of MC1R affecting melan...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/85
CPCC12N15/85C07K14/723C12N2800/106C12N2810/10Y02A50/30
Inventor 班谦惠文巧刘大海叶守东何侃
Owner ANHUI UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More