Primer combination for identifying three medicinal snakes and application thereof

A primer combination, primer pair technology, applied in recombinant DNA technology, microbial determination/inspection, biochemical equipment and methods, etc., can solve the problems of long testing time, unfavorable application and promotion, etc.

Active Publication Date: 2017-05-10
华润三九现代中药制药有限公司 +2
View PDF3 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Since there is no uniform identification method for the three kinds of snakes, when identifying medicinal snakes, it is necessary to carry out character detection at the same time, and it is necessary to use their own specific primers for PCR amplification of vipers and black snakes, and these methods test It takes a long time and requires electrophoresis detection to complete, which is not conducive to the application and promotion of on-site rapid identification

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer combination for identifying three medicinal snakes and application thereof
  • Primer combination for identifying three medicinal snakes and application thereof
  • Primer combination for identifying three medicinal snakes and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0092] Embodiment 1, primer design

[0093]Extensive sequence analysis of the genomes of various snake species yielded several primers for the identification of vipers, vipers, and vipers. Preliminary experiments were carried out on each primer to compare the performance of sensitivity and specificity, and finally three sets of primer pairs were obtained for the identification of vipers, black snakes and white snakes.

[0094] The primer pair (primer pair I) used to identify Vipers consists of primer F1 and primer F2 (5'→3'):

[0095] F1 (sequence 1 of the sequence listing): CTATACCTAATATTCGGCGCT;

[0096] F2 (sequence 2 of the sequence listing): CGGAGAGAGGTGGATAGACG;

[0097] The primer pair (primer pair II) used to identify black snakes consists of primer F3 and primer F4 (5'→3'):

[0098] F3 (sequence 3 of the sequence listing): CAGACATAGCCTTCCCACGC;

[0099] F4 (sequence 4 of the sequence listing): GGGGGGTATACTGTTCACCCA;

[0100] The primer pair (primer pair III) used...

Embodiment 2

[0104] Embodiment 2, identification method establishment

[0105] 1. Agarose gel electrophoresis

[0106] 1. Extract the genomic DNA of the sample to be tested.

[0107] 2. Using the genomic DNA obtained in step 1 as a template, use primer pair I, primer pair II and primer pair III in the primer combination prepared in Example 1 to perform PCR amplification respectively to obtain amplified products.

[0108] PCR amplification system (25 μL): 2.5 μL 10×buffer, 1.6 μL dNTP (2.5 mM), 0.4 μL primer F1, 0.4 μL primer F2, 0.4 μL primer F3, 0.4 μL primer F4, 0.4 μL primer F5, 0.4 μL μL primer F6, 0.2 μL SpeedStar HS Taq DNA polymerase, 2 μL template, 16.3 μL sterile double distilled water.

[0109] PCR reaction program: pre-denaturation: 95°C, 1min; denaturation: 95°C, 10s, annealing: 60°C, 10s, 30 cycles; 4°C storage.

[0110] 3. Perform 1.5% agarose gel electrophoresis on the amplified product obtained in step 2, and judge as follows according to the result:

[0111] If the amp...

Embodiment 3

[0121] Embodiment 3, identification method verification

[0122] Samples to be tested: 37 samples of snake medicinal materials of known species from different collection places shown in Table 1. The samples of Chinese herbal medicines in the table are all in compliance with the relevant regulations under the main text of the Chinese Pharmacopoeia (2015 edition) under each medicinal material. Through the identification, the real medicinal materials of each flavor are consistent with the names, and the quality meets the standards.

[0123] The samples to be tested were identified by the agarose gel electrophoresis method and the fluorescent staining method established in Example 2. In the PCR reaction system, the DNA content of the template was 20 ng.

[0124] Table 1 Sample source table

[0125]

[0126]

[0127]

[0128] Some results of identification by agarose gel electrophoresis can be found in figure 1 . Will figure 1 The 124bp target bands in lane 1 and lane...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a primer combination for identifying three medicinal snakes and an application thereof. The primer combination disclosed by the invention is composed of six single stranded DNA molecules as shown by the sequences 1-6. The invention further sets forth the application of the primer combination for identifying a long-nosed pit viper, a zaocys dhumnade and a little multibanded krait. The invention further discloses a method for identifying long-nosed pit viper, zaocys dhumnade and little multibanded krait. According to the invention, the existence of the medicinal snakes (long-nosed pit viper, zaocys dhumnade and little multibanded krait) can be simultaneously identified by carrying out PCR reaction once and the existence of specific medicinal snake species can be detected according to the size of the gel electrophoresis stripe. Meanwhile, the primer combination disclosed by the invention also can be used for identifying the mixed sample of long-nosed pit viper, zaocys dhumnade and little multibanded krait.

Description

technical field [0001] The invention relates to a combination of primers for identifying three kinds of medicinal snakes and its application. Background technique [0002] Snake medicinal materials, including snake meat, snake gall, and snake slough, are an important part of traditional Chinese medicine. They often have the functions of expelling wind and dampness, dredging collaterals and relieving convulsions, cooling and improving eyesight, relieving cough and reducing phlegm, etc. Widely used, the current 2015 edition of the "Chinese Pharmacopoeia" standard has recorded three kinds of medicinal snakes, vipers, black snakes and white snakes. There are more than 200 species of snakes in my country, of which more than 20 are common snakes, including Agkistrodon acutus, Zaocysdhumnades, Bungarus multicinctus, Bungarus fasciatus, Ptyas mucosus, Daboia russelii, Naja naja, Enhydrischinensis, Enhydris plumbea, Lycodon rufozonatus, Elaphecarinata, Oocatochus rufodsata, Ptyas kor...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/686C12Q1/6888C12Q2565/125C12Q2563/107
Inventor 袁媛蒋超黄璐琦赵玉洋
Owner 华润三九现代中药制药有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap