Allelic gene GL/gl pair for controlling haired/hairless property of cucumis melo
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A kind of gene, melon technology, applied in the field of genetic engineering, can solve the problem of positioning, cloning and the molecular mechanism of the formation of research gaps, stay and other problems
Active Publication Date: 2017-05-31
HENAN AGRICULTURAL UNIVERSITY
View PDF1 Cites 2 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
[0005] Generally speaking, there are few domestic and foreign research reports on the glabrous traits of melon, and they only focus on the analysis of genetic rules and physiological characteristics. Mechanism research is still blank
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0037] The analysis process of the hairy / hairless gene in melon in this application includes the construction of genetic segregation population, preliminary positioning, fine positioning and map-based cloning, and the positioning results are as follows: figure 1 As shown, the relevant experimental process is briefly introduced as follows:
[0038] 1. Construction of genetic segregation populations
[0039] The melon hairless material NSL73046 was used as the female parent, and the normal melon material M68 was used as the male parent (it should be explained that during the experiment, considering the availability of materials and the convenience of operation, the inventor used M68 as the male parent, and used other homozygous When there are hairy materials, related experiments can also be carried out), using these two parents to configure a hybrid combination, the results show that the obtained F 1 Progeny plants are normally hairy.
[0040] from F 1 Select 10 individual p...
Embodiment 2
[0077] On the basis of the sequencing results of Example 1, based on GL and gl The exon TCA-TAA mutation site can be designed to identify Gl and gl The dCAPS molecular marker of the gene is named as dCAPS1. When the dCAPS1 molecular marker is used for PCR amplification, the primer sequence is:
[0078] dCAPS1-F: 5' GGTTGCGGGAGATGGGAATT 3'
[0079] dCAPS1-R: 5'TGAAACTCGTGAAGCTTCGGTTC 3';
[0080] Using this primer pair, the PCR amplification product in the hairless parent material is 124bp, and the base sequence is as shown in SEQ ID NO.3; the PCR amplification sequence in the hairy parent is 124bp long, and the base sequence is as in SEQ ID As shown in NO.4;
[0081] Comparing the sequences of SEQ ID NO.3 and SEQ ID NO.4, the sequences of SEQ ID NO.3 and SEQ ID NO.4 have a base mutation at 21bp, so SEQ ID NO.4 has a mutation at 16-21bp The restriction site of EcoR1, that is, the sequence contains the restriction endonuclease EcoR1 restriction site 5'-GAATTC-3', so after...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more
PUM
Login to view more
Abstract
The invention belongs to the field of gene engineering, and particularly relates to a pair of allelic gene GL/gl for controlling haired/hairless property of cucumis melo. The gene gl for controlling the haireless property of cucumis melo is recessively homozygous in a hairless material, has a whole length of 536bp, and has a specific base sequence as shown in SEQ ID NO.1; the gene GL for controlling haired property of cucumis melo is dominantly homozygous or heterozygous in a haired material, and has a specific base sequence as shown in SEQ ID NO.2. The allelic gene GL/gl is used for finely mapping hairless property of cucumis melo for the first time, and realizes final cloning for GL/gl genes by further utilizing chromosome walking, and has an important meaning on understanding cucumis melo epidermal hair formation mechanism and controlling network thereof; and a stable specific dCAPS functional marker for the genes is developed according to the sequence difference of the genes in haired materials and hairless materials. The pair of allelic gene GL/gl can be simply and efficiently applied to molecular marker assisted breeding.
Description
technical field [0001] The invention belongs to the field of genetic engineering, in particular to a pair of alleles controlling the development of melon trichomes (hairy / hairless) GL / gl . Background technique [0002] melon( Cucumis melo L.) is an annual crop of Cucurbitaceae Melon, which has a wide range of genetic and phenotypic diversity. my country is one of the first countries in the world to cultivate melons, and it is also the country with the largest cultivation area and the highest yield of melons in the world. Melons have been cultivated in my country for more than 3,000 years, and North China is the secondary origin center of thin-skinned melons. [0003] Stems, leaves, calyxes, and ovaries of normal melon plants are covered with epidermal trichomes, which are multicellular and non-glandular. Plant epidermis has a series of functions, it can serve as the first barrier to protect plants from insects and pathogens, and reduce biotic and abiotic stresses suc...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to view more 
Login to view more