Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Allelic gene GL/gl pair for controlling haired/hairless property of cucumis melo

A kind of gene, melon technology, applied in the field of genetic engineering, can solve the problem of positioning, cloning and the molecular mechanism of the formation of research gaps, stay and other problems

Active Publication Date: 2017-05-31
HENAN AGRICULTURAL UNIVERSITY
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Generally speaking, there are few domestic and foreign research reports on the glabrous traits of melon, and they only focus on the analysis of genetic rules and physiological characteristics. Mechanism research is still blank

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Allelic gene GL/gl pair for controlling haired/hairless property of cucumis melo
  • Allelic gene GL/gl pair for controlling haired/hairless property of cucumis melo

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] The analysis process of the hairy / hairless gene in melon in this application includes the construction of genetic segregation population, preliminary positioning, fine positioning and map-based cloning, and the positioning results are as follows: figure 1 As shown, the relevant experimental process is briefly introduced as follows:

[0038] 1. Construction of genetic segregation populations

[0039] The melon hairless material NSL73046 was used as the female parent, and the normal melon material M68 was used as the male parent (it should be explained that during the experiment, considering the availability of materials and the convenience of operation, the inventor used M68 as the male parent, and used other homozygous When there are hairy materials, related experiments can also be carried out), using these two parents to configure a hybrid combination, the results show that the obtained F 1 Progeny plants are normally hairy.

[0040] from F 1 Select 10 individual p...

Embodiment 2

[0077] On the basis of the sequencing results of Example 1, based on GL and gl The exon TCA-TAA mutation site can be designed to identify Gl and gl The dCAPS molecular marker of the gene is named as dCAPS1. When the dCAPS1 molecular marker is used for PCR amplification, the primer sequence is:

[0078] dCAPS1-F: 5' GGTTGCGGGAGATGGGAATT 3'

[0079] dCAPS1-R: 5'TGAAACTCGTGAAGCTTCGGTTC 3';

[0080] Using this primer pair, the PCR amplification product in the hairless parent material is 124bp, and the base sequence is as shown in SEQ ID NO.3; the PCR amplification sequence in the hairy parent is 124bp long, and the base sequence is as in SEQ ID As shown in NO.4;

[0081] Comparing the sequences of SEQ ID NO.3 and SEQ ID NO.4, the sequences of SEQ ID NO.3 and SEQ ID NO.4 have a base mutation at 21bp, so SEQ ID NO.4 has a mutation at 16-21bp The restriction site of EcoR1, that is, the sequence contains the restriction endonuclease EcoR1 restriction site 5'-GAATTC-3', so after...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of gene engineering, and particularly relates to a pair of allelic gene GL / gl for controlling haired / hairless property of cucumis melo. The gene gl for controlling the haireless property of cucumis melo is recessively homozygous in a hairless material, has a whole length of 536bp, and has a specific base sequence as shown in SEQ ID NO.1; the gene GL for controlling haired property of cucumis melo is dominantly homozygous or heterozygous in a haired material, and has a specific base sequence as shown in SEQ ID NO.2. The allelic gene GL / gl is used for finely mapping hairless property of cucumis melo for the first time, and realizes final cloning for GL / gl genes by further utilizing chromosome walking, and has an important meaning on understanding cucumis melo epidermal hair formation mechanism and controlling network thereof; and a stable specific dCAPS functional marker for the genes is developed according to the sequence difference of the genes in haired materials and hairless materials. The pair of allelic gene GL / gl can be simply and efficiently applied to molecular marker assisted breeding.

Description

technical field [0001] The invention belongs to the field of genetic engineering, in particular to a pair of alleles controlling the development of melon trichomes (hairy / hairless) GL / gl . Background technique [0002] melon( Cucumis melo L.) is an annual crop of Cucurbitaceae Melon, which has a wide range of genetic and phenotypic diversity. my country is one of the first countries in the world to cultivate melons, and it is also the country with the largest cultivation area and the highest yield of melons in the world. Melons have been cultivated in my country for more than 3,000 years, and North China is the secondary origin center of thin-skinned melons. [0003] Stems, leaves, calyxes, and ovaries of normal melon plants are covered with epidermal trichomes, which are multicellular and non-glandular. Plant epidermis has a series of functions, it can serve as the first barrier to protect plants from insects and pathogens, and reduce biotic and abiotic stresses suc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/11C12Q1/68
CPCC12Q1/6895C12Q2600/13C12Q2600/156
Inventor 杨路明朱华玉马长生李严曼胡建斌孙守如朱磊孙小粉
Owner HENAN AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com