Rice booting stage cold tolerance related protein CTB4a, coding gene and application thereof
A protein and coding technology, which is applied to the cold tolerance-related protein CTB4a in rice booting stage and the coding gene and application fields, can solve the problems of slow progress and long variety cycle.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0053] Embodiment 1, location and cloning of CTB4a gene
[0054] 1. Acquisition of CTB4a gene
[0055] Using the segregation population constructed by the cold-tolerant variety KMXBG and the cold-sensitive variety Towada, the seed setting rate of each individual plant in Kunming and Aziying was investigated as the phenotypic data for QTL mapping ( figure 1 , figure 2). At the same time, the BSA method was used to screen out the polymorphic markers from 1513 pairs of SSR markers evenly distributed on the 12 chromosomes of rice. for H. Mapmaker3.0 was used for marker linkage mapping, the Group command was used for grouping, and the Kosambi method was used to calculate the genetic distance. The QTL scan adopts QTLIciMapping 3.0 (Wang Jiankang et al., 2009), and the LOD value of 3.0 is used as the threshold for the existence of QTL, and the additive and dominant effects are calculated at the same time. The naming principle of QTL adopts the naming method of McCouch et al. F...
Embodiment 2
[0072] Example 2, functional verification of CTB4a gene
[0073] 1. Construction of CTB4a overexpression recombinant vector
[0074] Genomic DNA of rice KMXBG was extracted as a template, and PCR amplification was performed with Cb1F and Cb1R to obtain a PCR product of 4676 bp. After sequencing, the PCR product was genomic DNA of CTB4a gene, as shown in sequence 3 of the sequence table.
[0075] Cb1F: GCAACTAGTCTCCCCATTGTCAGTGCCA (restriction enzyme AscI)
[0076] CblR: CCTTAATTAATTCACAACAAACTCGCATCA (restriction enzyme PacI).
[0077] The genomic DNA of the CTB4a gene shown in Sequence 3 of the above sequence listing was substituted for the fragment between the AscI and PacI restriction sites on the expression vector pMDC32 to obtain the recombinant vector 35S::CTB4a (that is, the CTB4a overexpression recombinant vector, the structural diagram is as follows: Figure 5 ), wherein the CTB4a gene was inserted downstream of the double tobacco mosaic virus promoter 35S.
[0078...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


