Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Rice booting stage cold tolerance related protein CTB4a, coding gene and application thereof

A protein and coding technology, which is applied to the cold tolerance-related protein CTB4a in rice booting stage and the coding gene and application fields, can solve the problems of slow progress and long variety cycle.

Active Publication Date: 2017-09-01
CHINA AGRI UNIV
View PDF1 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, it takes a long time to cultivate cold-tolerant rice varieties using traditional breeding methods, and the progress is relatively slow. However, genetic engineering technology can directly modify the genetic background of plants at the genetic level, and the genetic traits of plants can be directional modified

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rice booting stage cold tolerance related protein CTB4a, coding gene and application thereof
  • Rice booting stage cold tolerance related protein CTB4a, coding gene and application thereof
  • Rice booting stage cold tolerance related protein CTB4a, coding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] Embodiment 1, location and cloning of CTB4a gene

[0054] 1. Acquisition of CTB4a gene

[0055] Using the segregation population constructed by the cold-tolerant variety KMXBG and the cold-sensitive variety Towada, the seed setting rate of each individual plant in Kunming and Aziying was investigated as the phenotypic data for QTL mapping ( figure 1 , figure 2). At the same time, the BSA method was used to screen out the polymorphic markers from 1513 pairs of SSR markers evenly distributed on the 12 chromosomes of rice. for H. Mapmaker3.0 was used for marker linkage mapping, the Group command was used for grouping, and the Kosambi method was used to calculate the genetic distance. The QTL scan adopts QTLIciMapping 3.0 (Wang Jiankang et al., 2009), and the LOD value of 3.0 is used as the threshold for the existence of QTL, and the additive and dominant effects are calculated at the same time. The naming principle of QTL adopts the naming method of McCouch et al. F...

Embodiment 2

[0072] Example 2, functional verification of CTB4a gene

[0073] 1. Construction of CTB4a overexpression recombinant vector

[0074] Genomic DNA of rice KMXBG was extracted as a template, and PCR amplification was performed with Cb1F and Cb1R to obtain a PCR product of 4676 bp. After sequencing, the PCR product was genomic DNA of CTB4a gene, as shown in sequence 3 of the sequence table.

[0075] Cb1F: GCAACTAGTCTCCCCATTGTCAGTGCCA (restriction enzyme AscI)

[0076] CblR: CCTTAATTAATTCACAACAAACTCGCATCA (restriction enzyme PacI).

[0077] The genomic DNA of the CTB4a gene shown in Sequence 3 of the above sequence listing was substituted for the fragment between the AscI and PacI restriction sites on the expression vector pMDC32 to obtain the recombinant vector 35S::CTB4a (that is, the CTB4a overexpression recombinant vector, the structural diagram is as follows: Figure 5 ), wherein the CTB4a gene was inserted downstream of the double tobacco mosaic virus promoter 35S.

[0078...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a rice booting stage cold tolerance related protein CTB4a, a coding gene and application thereof. The invention provides a protein shown as 1) or 2) in the following: 1) a protein shown as sequence 2 in a sequence table; and 2) a sequence 2 derived protein that is obtained by substitution and / or deletion and / or adding of one or several amino acid residues to the amino acid sequence shown as sequence 2 in the sequence table and has the same function. Experiments of the invention prove that the invention clones a new positively regulated rice booting stage cold tolerance related gene CTB4a, the CTB4a shows cold tolerance at the booting stage after being transferred into wild type rice, thus providing gene resources for breeding of rice's cold tolerant varieties.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a rice booting stage cold tolerance-related protein CTB4a and its coding gene and application. Background technique [0002] Abiotic stress is one of the main stress factors that affect the normal growth and development of plants and limit the improvement of crop yield. Rice is a temperature-loving plant, and low temperature affects rice high yield, stable yield, quality and the expansion of rice multiple cropping area. Low-temperature chilling injury of rice usually refers to the impact of continuous or short-term low temperature below the lowest critical temperature of rice, which delays the growth of crops and even causes physiological disorders. production cuts. [0003] According to the period of chilling injury, rice chilling injury is generally divided into chilling injury at germination stage, chilling injury at seedling stage, and chilling injury at booting stage. The flo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/415C12N15/29A01H5/00
CPCC07K14/415C12N15/8273
Inventor 李自超张战营李金杰潘英华周雷李继龙张洪亮
Owner CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com