Check patentability & draft patents in minutes with Patsnap Eureka AI!

Application of a gametocyte recombinant protein rpbg37 of Plasmodium berghei in blocking malaria transmission

A recombinant protein and Plasmodium technology, applied in the field of immunology, can solve the problem of not being able to achieve the effect of blocking transmission

Inactive Publication Date: 2020-05-12
中国医科大学
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the specific antibodies induced by these sexual stage vaccine candidate antigens of Plasmodium have not yet achieved a satisfactory transmission blocking effect.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of a gametocyte recombinant protein rpbg37 of Plasmodium berghei in blocking malaria transmission
  • Application of a gametocyte recombinant protein rpbg37 of Plasmodium berghei in blocking malaria transmission
  • Application of a gametocyte recombinant protein rpbg37 of Plasmodium berghei in blocking malaria transmission

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Identification of candidate antigen PbG37 of malaria transmission blocking vaccine and preparation of its recombinant protein.

[0041] 1. Identify and predict the structural features and functions of PbG37 using molecular bioinformatics techniques.

[0042] The PbG37 (PBANKA_060330) gene is described in the Plasmodium database as a "conserved Plasmodium protein of unknown function". SMART analysis showed that the PbG37 protein contained a signal peptide, two low-complexity regions and seven transmembrane regions. In order to express the soluble protein, we avoided the signal peptide and the transmembrane region and obtained a B cell epitope enrichment region. Fragment, that is, the 26th to 88th amino acid residues from the N-terminal, a total of 63 amino acid residues as the amino acid sequence of rPbG37 designed in the present invention, see figure 1 , the figure shows that the protein has a signal peptide, two low-complexity regions and seven transmembrane regions, ...

Embodiment 2

[0065] Preparation of immune serum and protein localization.

[0066] 1. Preparation of immune serum.

[0067] Ten BALB / c female mice aged 6-8 weeks were divided into 2 groups, 5 in each group. Group 1 was injected with the recombinant protein prepared in Example 1, and Group 2 was the PBS control group. Grind the purified recombinant protein (50 μg / mouse) and complete Freund’s adjuvant into a water-in-oil emulsion, and inject 100 μl / mouse subcutaneously to immunize mice. In the 3rd week and the 5th week, two booster immunizations were given respectively, 25 μg of the recombinant protein was ground with Freund’s incomplete adjuvant to form a water-in-oil emulsion, and 100 μl / mouse was injected subcutaneously to immunize the mice. The mouse serum was collected 10 days after the third immunization, and the specific antibody level of the mouse serum was detected by ELISA. Compared with the PBS immunization group, the antibody level was significantly increased (p Figure 4 , the ...

Embodiment 3

[0074] Construction of targeting vector and acquisition of Δpbg37 malaria parasite.

[0075] 1. Construction of targeting vector for gene knockout.

[0076] The pbg37 gene was targeted to be knocked out by double-crossover homologous recombination, and a gene knockout targeting vector was successfully constructed. According to the vector construction flow chart, see Figure 7 , PbG37 is the target gene, 5'UTR and 3'UTR are the homology arms on both sides of the target gene, and P1, P2, P3, P4 and P5 are designed primers for identifying gene knockout genotypes.

[0077] First, the PCR method was used to successfully amplify the 5'UTR fragment, the amplified length was 699bp, and the 5' ends of the upstream and downstream primers were respectively introduced with restriction endonuclease HindⅢ and PstI restriction sites; the primer sequence is as follows: pbg37-5U-F (SEQ ID NO: 5): CCCAAGCTTG TGTTGAAAAT GCTATCGAAA T; pbg37-5U-R (SEQ ID NO: 6): AACTGCAGAAAGACCTTTGG ATGATTTG; Th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention belongs to the field of immunology and particularly relates to Plasmodium berghei gametophyte recombinant protein (rPbG37), a preparation method thereof and application of the Plasmodium berghei gametophyte recombinant protein (rPbG37) in malaria transmission blocking. The amino acid sequence of the Plasmodium berghei gametophyte recombinant protein (rPbG37) is as shown in SEQ ID No. 1; or the amino acid sequence of the Plasmodium berghei gametophyte recombinant protein (rPbG37) is an amino acid sequence whose homology with an amino acid sequence defined by the sequence as shown in SEQ ID No. 1 is 95-100% and encoding identical functional protein; or the amino acid sequence of the Plasmodium berghei gametophyte recombinant protein (rPbG37) is an amino acid sequence obtained by increasing, deleting or replacing one or more amino acid of the amino acid sequence as shown in SEQ ID No. 1 and provided with identical-activity derivative protein. The recombinant protein is novel recombinant protein with a transmission blocking effect and can further increase a malaria transmission blocking effect.

Description

technical field [0001] The invention belongs to the field of immunology, and in particular relates to a Plasmodium berghei gametocyte recombinant protein (rPbG37), a preparation method thereof and an application in the process of blocking malaria transmission. Background technique [0002] Malaria is an infectious parasitic disease transmitted by Plasmodium via Anopheles mosquitoes, which seriously threatens human health. The latest WHO global malaria report pointed out that in 2015 alone, about 429,000 people died of malaria worldwide. In high-density malaria endemic areas, currently available anti-malarial methods are no longer sufficient to block the spread of malaria, and the increase and prevalence of drug-resistant mosquitoes and Plasmodium have further increased the difficulty of malaria control. Therefore, the International Expert Committee on Malaria Elimination (MalERA) believes that the key measure to control the spread of malaria is to develop new control methods...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/445C12N15/30A61K39/015A61P33/06
CPCA61K39/015C07K14/445Y02A50/30
Inventor 曹雅明刘飞王庆辉冯辉王亚茹李莉杨帆洪民生
Owner 中国医科大学
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More