Application of a gametocyte recombinant protein rpbg37 of Plasmodium berghei in blocking malaria transmission
A recombinant protein and Plasmodium technology, applied in the field of immunology, can solve the problem of not being able to achieve the effect of blocking transmission
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] Identification of candidate antigen PbG37 of malaria transmission blocking vaccine and preparation of its recombinant protein.
[0041] 1. Identify and predict the structural features and functions of PbG37 using molecular bioinformatics techniques.
[0042] The PbG37 (PBANKA_060330) gene is described in the Plasmodium database as a "conserved Plasmodium protein of unknown function". SMART analysis showed that the PbG37 protein contained a signal peptide, two low-complexity regions and seven transmembrane regions. In order to express the soluble protein, we avoided the signal peptide and the transmembrane region and obtained a B cell epitope enrichment region. Fragment, that is, the 26th to 88th amino acid residues from the N-terminal, a total of 63 amino acid residues as the amino acid sequence of rPbG37 designed in the present invention, see figure 1 , the figure shows that the protein has a signal peptide, two low-complexity regions and seven transmembrane regions, ...
Embodiment 2
[0065] Preparation of immune serum and protein localization.
[0066] 1. Preparation of immune serum.
[0067] Ten BALB / c female mice aged 6-8 weeks were divided into 2 groups, 5 in each group. Group 1 was injected with the recombinant protein prepared in Example 1, and Group 2 was the PBS control group. Grind the purified recombinant protein (50 μg / mouse) and complete Freund’s adjuvant into a water-in-oil emulsion, and inject 100 μl / mouse subcutaneously to immunize mice. In the 3rd week and the 5th week, two booster immunizations were given respectively, 25 μg of the recombinant protein was ground with Freund’s incomplete adjuvant to form a water-in-oil emulsion, and 100 μl / mouse was injected subcutaneously to immunize the mice. The mouse serum was collected 10 days after the third immunization, and the specific antibody level of the mouse serum was detected by ELISA. Compared with the PBS immunization group, the antibody level was significantly increased (p Figure 4 , the ...
Embodiment 3
[0074] Construction of targeting vector and acquisition of Δpbg37 malaria parasite.
[0075] 1. Construction of targeting vector for gene knockout.
[0076] The pbg37 gene was targeted to be knocked out by double-crossover homologous recombination, and a gene knockout targeting vector was successfully constructed. According to the vector construction flow chart, see Figure 7 , PbG37 is the target gene, 5'UTR and 3'UTR are the homology arms on both sides of the target gene, and P1, P2, P3, P4 and P5 are designed primers for identifying gene knockout genotypes.
[0077] First, the PCR method was used to successfully amplify the 5'UTR fragment, the amplified length was 699bp, and the 5' ends of the upstream and downstream primers were respectively introduced with restriction endonuclease HindⅢ and PstI restriction sites; the primer sequence is as follows: pbg37-5U-F (SEQ ID NO: 5): CCCAAGCTTG TGTTGAAAAT GCTATCGAAA T; pbg37-5U-R (SEQ ID NO: 6): AACTGCAGAAAGACCTTTGG ATGATTTG; Th...
PUM
Property | Measurement | Unit |
---|---|---|
molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap