Molecular marker for identifying genetic gender of pseudosciaena crocea and application thereof
A technology of molecular markers and large yellow croakers, which is applied in the field of molecular markers to identify the genetic sex of large yellow croakers, can solve the problems of unseen reports and achieve the effects of saving time, convenient operation and promoting the breeding process
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0043] Example 1: Sex-specific molecular markers of large yellow croaker
[0044] Large yellow croaker is a diploid organism with XX / XY sex determination system, female is XX and male is XY. Through the comparative analysis of the whole genome resequencing data of 6 groups of male and female large yellow croakers, the results show that there is a 15bp deletion in the sequence from the male fish, such as figure 1 . Since the sequence of the male X chromosome is the same as that of the two female X chromosomes, and this fragment is only missing in the male fish but not in the female fish, it is speculated that the missing fragment may exist on the male Y chromosome. Further statistical analysis was performed on the read lengths containing 15bp fragments in the 6 sets of data, and the statistical results are shown in Table 1.
[0045] Table 1 Statistical table of read lengths with 15 bp deletion in the whole genome resequencing sequence of male and female large yellow croaker ...
Embodiment 2
[0050] Example 2, identification and identification of the genetic sex of large yellow croaker
[0051] Cut off part of the fin rays of the large yellow croaker to be tested, put them in 95% alcohol solution, and store them at -20°C. The sex of the corresponding individuals is confirmed by anatomical and histological observation and recorded. Genomic DNA was extracted using a DNA extraction kit, and the resulting genomic DNA was diluted to about 30ng / μl as a template for later use;
[0052] The applicant designed the following two pairs of primers (the LYC-MFS primers have been used for the verification of the above molecular markers):
[0053] a. LYC-MS primers
[0054] LYC-MS-F:5'GGCTCTGTGAGGCGTCTT3' SEQ ID NO:2
[0055] LYC-MS-R:5'CTTACAGTTATCTGCAATTTGTATG3' SEQ ID NO:3
[0056] b. LYC-MFS primer
[0057] LYC-MFS-F:5'TGGCTCTGTGAGGCGTCT3' SEQ ID NO:4
[0058] LYC-MFS-R:5'ATACAATGATGACATCAATCCTGAT3' SEQ ID NO:5
[0059] Wherein, the downstream primers of LYC-MS span the...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



