Unlock instant, AI-driven research and patent intelligence for your innovation.

Molecular marker for identifying genetic gender of pseudosciaena crocea and application thereof

A technology of molecular markers and large yellow croakers, which is applied in the field of molecular markers to identify the genetic sex of large yellow croakers, can solve the problems of unseen reports and achieve the effects of saving time, convenient operation and promoting the breeding process

Active Publication Date: 2017-10-10
JIMEI UNIV
View PDF7 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Molecular markers that can identify and identify (identify) the genetic sex of large yellow croaker have not been reported so far at home and abroad

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker for identifying genetic gender of pseudosciaena crocea and application thereof
  • Molecular marker for identifying genetic gender of pseudosciaena crocea and application thereof
  • Molecular marker for identifying genetic gender of pseudosciaena crocea and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Example 1: Sex-specific molecular markers of large yellow croaker

[0044] Large yellow croaker is a diploid organism with XX / XY sex determination system, female is XX and male is XY. Through the comparative analysis of the whole genome resequencing data of 6 groups of male and female large yellow croakers, the results show that there is a 15bp deletion in the sequence from the male fish, such as figure 1 . Since the sequence of the male X chromosome is the same as that of the two female X chromosomes, and this fragment is only missing in the male fish but not in the female fish, it is speculated that the missing fragment may exist on the male Y chromosome. Further statistical analysis was performed on the read lengths containing 15bp fragments in the 6 sets of data, and the statistical results are shown in Table 1.

[0045] Table 1 Statistical table of read lengths with 15 bp deletion in the whole genome resequencing sequence of male and female large yellow croaker ...

Embodiment 2

[0050] Example 2, identification and identification of the genetic sex of large yellow croaker

[0051] Cut off part of the fin rays of the large yellow croaker to be tested, put them in 95% alcohol solution, and store them at -20°C. The sex of the corresponding individuals is confirmed by anatomical and histological observation and recorded. Genomic DNA was extracted using a DNA extraction kit, and the resulting genomic DNA was diluted to about 30ng / μl as a template for later use;

[0052] The applicant designed the following two pairs of primers (the LYC-MFS primers have been used for the verification of the above molecular markers):

[0053] a. LYC-MS primers

[0054] LYC-MS-F:5'GGCTCTGTGAGGCGTCTT3' SEQ ID NO:2

[0055] LYC-MS-R:5'CTTACAGTTATCTGCAATTTGTATG3' SEQ ID NO:3

[0056] b. LYC-MFS primer

[0057] LYC-MFS-F:5'TGGCTCTGTGAGGCGTCT3' SEQ ID NO:4

[0058] LYC-MFS-R:5'ATACAATGATGACATCAATCCTGAT3' SEQ ID NO:5

[0059] Wherein, the downstream primers of LYC-MS span the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a molecular marker for identifying genetic gender of pseudosciaena crocea and application thereof. The molecular marker is featured as the insertion / deletion length polymorphism of a nucleotide sequence shown in SEE ID NO: 1. The molecular marker is closely related with the gender of the pseudosciaena crocea, and can be used for the auxiliary breeding of the pseudosciaena crocea.

Description

technical field [0001] The invention relates to fish genetic sex identification and sex control technology in the technical field of aquatic organisms, in particular to a molecular marker for identifying the genetic sex of large yellow croaker and its application. Background technique [0002] In the field of life science research, gender research has always been a hot topic, attracting the attention of many researchers. Fish is in the position of connecting the past and the future in the evolution of animals, and the number of species is abundant. Similar to most vertebrates, many fishes are dioecious and sexually dimorphic, that is, they show significant differences between males and females in morphology and physiology. Moreover, important economic traits such as individual growth and economic value of some fish species are closely related to sex. Therefore, the development of single-sex breeding and culture techniques for these fishes has great significance in the fish...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6858C12Q1/6879C12Q2600/156C12Q2531/113C12Q2565/125
Inventor 王志勇林爱强肖世俊
Owner JIMEI UNIV