Preparation method and application of humanized gene modification animal model

A technology of animal models and non-human animals, applied in botany equipment and methods, biochemical equipment and methods, plant genetic improvement, etc., to speed up the research and development process, reduce the risk of drug development, and save time and cost

Active Publication Date: 2018-03-20
BIOCYTOGEN PHARMACEUTICALS (BEIJING) CO LTD +1
View PDF3 Cites 29 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, most research is still in its infancy, and drug development is still in clinical phase I or II

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method and application of humanized gene modification animal model
  • Preparation method and application of humanized gene modification animal model
  • Preparation method and application of humanized gene modification animal model

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0174] Example 1 Construction of pT7-OX-6 and pT7-OX-12

[0175] The target sequence determines the specificity of sgRNA targeting and the efficiency of inducing Cas9 to cut the target gene. Therefore, efficient and specific target sequence selection and design are the prerequisites for constructing sgRNA expression vectors.

[0176] Taking mice as an example, design and synthesize a guide RNA sequence that recognizes the 5'end target site (sgRNA1-sgRNA7) and the 3'end target site (sgRNA9-sgRNA16). According to the function and sequence characteristics of Ox40 gene, the 5'end target site and the 3'end target site are located on the second exon and fifth exon of the mouse Ox40 gene, respectively, and each sgRNA is the target site on Ox40 The point sequence is as follows:

[0177] sgRNA-1 target site sequence (SEQ ID NO:1): 5'-GTTAAACATACCTACCCCAGTGG-3'

[0178] sgRNA-2 target site sequence (SEQ ID NO: 2): 5'-CGACAGCACTTGTGACCACTGGG-3'

[0179] sgRNA-3 target site sequence (SEQ ID NO: ...

Embodiment 2

[0203] Example 2 Construction of vector pClon-4G-OX40

[0204] The main part of the mouse Ox40 gene (Gene ID: 22163) exon 1 to exon 5 (based on the transcript with NCBI accession number NM_011659.2→NP_035789.1, the mRNA sequence is as SEQ ID NO: 25, the corresponding protein sequence is shown in SEQ ID NO: 26) is replaced with the corresponding fragment of human OX40 gene (Gene ID: 7293) (based on the transcript with NCBI accession number NM_003327.3→NP_003318.1, the mRNA sequence is as The corresponding protein sequence is shown in SEQ ID NO: 27, and the corresponding protein sequence is shown in SEQ ID NO: 28), among which, the comparison diagram of mouse Ox40 and human OX40 is shown in image 3 , See the schematic diagram of the modified humanized mouse OX40 gene finally Figure 4 , The DNA sequence of humanized mouse OX40 gene (chimeric OX40 gene DNA) is shown in SEQ ID NO: 29:

[0205] TGTTAAACAT acatatcctagcaacgaccggtgctgccacgagtgcaggccaggtgaggcctcaggaggggtcgcca cgcacgggcac...

Embodiment 3

[0234] Example 3 Verification of vector pClon-4G-OX40

[0235] Randomly select 10 pClon-4G-OX40 clones and use 2 sets of enzymes for restriction enzyme digestion verification. Among them, EcoRI+ScaI should appear 4657bp+3296bp, HindIII+BglII should appear 4223bp+3116bp+614bp. See the enzyme digestion results Image 6 , Indicating that the plasmid numbers 1, 3, and 8 are digested correctly and the results are in line with expectations. Plasmids numbered 1 and 3 were verified by the sequencing company to be correct. Plasmid 3 was selected for subsequent experiments.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a humanized gene genetically modified non-human animal, particularly a genetically modified rodent, especially a genetically modified mouse, and in particular relates to a construction method of a humanized OX-40 gene animal model and application of the model in the biomedicine field.

Description

Technical field [0001] This application relates to a method for establishing a humanized genetically modified animal model and its application, specifically, to a method for building a humanized OX40 genetically modified animal model and its application in biomedicine. Background technique [0002] Generally, it is expected to use human cells for experiments in the research of human diseases. In particular, it is necessary to use a model of human gene expression to confirm the involvement of multiple species-specific drug-metabolizing enzymes, host-limited immune response and other diseases involved. [0003] Experimental animal disease models are indispensable research tools for studying the etiology and pathogenesis of human diseases, and developing prevention and treatment technologies and drugs. Common laboratory animals include mice, rats, guinea pigs, hamsters (hamsters), rabbits, dogs, monkeys, pigs, fish and so on. However, there are still many differences between human a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/85C12N15/90C12N15/113C12N15/12C07K14/705A01K67/027
CPCA01K67/0276A01K67/0278C07K14/70578C12N15/113C12N15/8509C12N15/907C12N2310/10C12N2800/107A01K2227/105A01K2217/072A01K2217/075A01K2267/03C12N2015/8572A01K2207/15A01K2267/0393C07K14/70575A01K2217/052
Inventor沈月雷郭朝设白阳姚佳维张美玲周小飞
OwnerBIOCYTOGEN PHARMACEUTICALS (BEIJING) CO LTD