Reagent for interfering with the expression of long-chain non-coding RNA PVT1 and its application

A long-chain non-coding and reagent technology, which is used in the preparation of nasopharyngeal cancer adjuvant therapy preparations and the field of reagents that interfere with the expression of long-chain non-coding RNA PVT1, can solve the problems that radiation cannot completely kill tumor cells, poor prognosis, and patient death, etc. Achieving clinically significant effects

Active Publication Date: 2020-03-20
THE SECOND PEOPLES HOSPITAL OF SHENZHEN +1
View PDF9 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Nasopharyngeal carcinoma is a common and high-incidence head and neck malignant tumor, prone to cervical lymph node metastasis, and the prognosis is poor. Radiation therapy is currently the main clinical treatment for nasopharyngeal carcinoma. Some patients with nasopharyngeal carcinoma have radiation resistance due to cancer cells ( Radioresistance), that is, insensitivity to radiation therapy, radiation cannot completely kill tumor cells, and the remaining tumor cells eventually recur and metastasize, leading to the death of patients

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Reagent for interfering with the expression of long-chain non-coding RNA PVT1 and its application
  • Reagent for interfering with the expression of long-chain non-coding RNA PVT1 and its application
  • Reagent for interfering with the expression of long-chain non-coding RNA PVT1 and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0060] Example 1, real-time fluorescent quantitative PCR method detection confirmed that PVT1 was up-regulated in nasopharyngeal carcinoma

[0061] 1. Materials and methods:

[0062] 32 cases of normal nasopharyngeal epithelial tissues and 61 cases of nasopharyngeal carcinoma tissues were collected, total RNA was extracted, 2 μg RNA was reverse transcribed into cDNA, and real-time fluorescent quantitative PCR was performed. PVT1 forward primer is 5'-TGG CTG AGA GGG TTG AGA TC-3' as shown in SEQ NO:2, and reverse primer 5'-GCT GTA TGT GCC AAG GTC AC-3' as shown in SEQ NO:3 .

[0063] The GAPDH forward primer used for control is 5'-ACCACAGTCCATGCCATCAC-3' as shown in SEQ NO:4, and the reverse primer 5'-TCCACCACCCTGTTGCTGTA-3' as shown in SEQ NO:5.

[0064] Real-time fluorescence quantitative PCR reaction system

[0065]

[0066] Real-time fluorescent quantitative PCR reaction steps

[0067] 1 94°C 5min

[0068] 2 95°C 10sec

[0069] 3 58°C 30sec

[0070] 4 72°C 20sec ...

Embodiment 2

[0079] Example 2, In situ hybridization detection found the expression of PVT1 in nasopharyngeal carcinoma, and its correlation with patient prognosis and radiotherapy sensitivity

[0080] 1. Material method

[0081] 1.1 Design and synthesis of hybridization probes

[0082] In order to detect the expression of PVT1 by in situ hybridization, we designed two groups of oligonucleotide probes for detection of PVT1 expression by in situ hybridization and three positive control in situ hybridization oligonucleotide probes.

[0083] Oligonucleotide probes for detection of PVT1 expression by in situ hybridization:

[0084] PVT1 probe 1: 5'-GGTCGGACTAGAAAACCGGTCTTCCTCTAATTTT-3' as shown in SEQ NO:6,

[0085] PVT1 probe 2: 5'-GAGACTGTAAAAACTTCTCAGGTCTTAGGA-3' as shown in SEQ NO:7,

[0086] PVT1 probe 3: 5'-CTCATAAAACTCTAACCTCTTAATTCTCGGTCAG-3' is shown in SEQ NO:8.

[0087] Positive control probe (to detect the housekeeping gene GAPDH):

[0088] GAPDH probe 1: 5'-CCACTTTACCAGAGTTAA...

Embodiment 3

[0153] Example 3, construction of shRNA vectors to interfere with the expression of PVT1

[0154] 1. Material method

[0155] 1.1 Reagents and kits

[0156] Restriction enzymes Hind III, Bgl II, EcoR I and Cla I, T4 DNA ligase, etc. were purchased from TakaRa;

[0157] TRIZOL TM Reagent (Invitrogen);

[0158] Plasmid Extraction Kit (#D6943-01, OMEGA);

[0159] Gel recovery kit (#M5212, OMEGA);

[0160] Reverse transcription kit (#A3500, Promega);

[0161] Antibiotic G418 (Ameresc).

[0162] 1.2 Design of shRNA

[0163] First, input the PVT1 sequence into Invitrogen's Block-It RNAi designer software to find the best shRNA target of the lncRNA, and select the best 3 corresponding target sequences as follows:

[0164] shRNA-1: GGACTTGAGAACTGTCCTTA as shown in SEQ NO: 12,

[0165] shRNA-2: GCTTCTCCTGTTGCTGCTAGT as shown in SEQ NO: 13,

[0166] shRNA-3: GCTCCACCCAGAAGCAATTCA shown in SEQ NO: 14,

[0167] The widely used Scramble sequence without any target in the human ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
particle diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses application of a reagent expressed by interference long chain RNA PVT1 in preparing a preparation for adjuvant therapy of nasopharyngeal carcinoma. Interference vectors of PVT1are transferred into cell lines CNE2 and 5-8F of the nasopharyngeal carcinoma; after the expression of the PVT1 is inhibited, the proportion of apoptotic cells is obviously increased, which shows that the reagent expressed by the interference long chain RNA PVT1 can be used for the adjuvant therapy of the nasopharyngeal carcinoma and has significant clinical treatment significance.

Description

technical field [0001] The invention belongs to the field of tumor molecular biology, and in particular relates to the application method of a reagent for interfering with the expression of long-chain non-coding RNA PVT1 in preparing nasopharyngeal carcinoma adjuvant treatment preparations. Background technique [0002] Human Genome Project and its follow-up DNA Elements Encyclopedia Project (The Encyclopedia of DNAElements Project, ENCODE) research results show that protein-coding gene sequences only account for 1-3% of the human genome sequence, while most of the human genome can be transcribed The sequence is long non-coding RNA (Long non-coding RNA, lncRNA). LncRNAs widely exist in various organisms, and with the increase of biological complexity, the proportion of lncRNA sequences in the genome increases accordingly, suggesting that lncRNAs are of great significance in the process of biological evolution. As lncRNAs are continuously discovered and their functions are g...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/113C12N15/85A61K48/00
CPCA61K31/7105C12N15/66C12N15/70C12Q1/6886C12Q2600/178
Inventor聂国辉谢妮熊炜苗北平肖志强曾朝阳何奕郭灿熊芳龚朝建张姗姗
OwnerTHE SECOND PEOPLES HOSPITAL OF SHENZHEN