Rice small molecule rnaosa-mir171b gene and its application in increasing rice yield
A small molecule, rice technology, applied in the direction of DNA / RNA fragments, applications, genetic engineering, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0020] It needs to be particularly pointed out that the specific embodiments of the present invention are only used as examples to illustrate how the present invention is realized, and such descriptions cannot form any limitation on the present invention. The scope of the present invention is reflected in the claims. In order to realize the object of the present invention, the following description is made by way of example.
[0021] According to the sequence of osa-miR171b obtained by high-throughput sequencing, the specific sequence information is as follows: 5'UGAUUGAGCCGUGCCAAUAUC 3', (SEQ ID NO: 1), replace the known osa-MIR528 front with this microRNA, osa-miR171b sequence The osa-miR528 sequence in the body sequence was obtained to obtain the artificial miR171b sequence osa-miR171b (SEQ ID NO: 2), wherein, the underlined part in sequence 2 is the corresponding sequence formed by the substitution of sequence 1, and the substitution here is not a simple substitution, but...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


