Supercharge Your Innovation With Domain-Expert AI Agents!

Rice small molecule rnaosa-mir171b gene and its application in increasing rice yield

A small molecule, rice technology, applied in the direction of DNA / RNA fragments, applications, genetic engineering, etc.

Active Publication Date: 2021-07-06
ZHEJIANG ACADEMY OF AGRICULTURE SCIENCES
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Rice (Oryza sativa L.) is an important food crop. In recent years, the successful application of hybrid rice in agricultural production has greatly increased the yield of rice. However, there is a certain limit to the increase of rice yield through hybridization

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rice small molecule rnaosa-mir171b gene and its application in increasing rice yield
  • Rice small molecule rnaosa-mir171b gene and its application in increasing rice yield
  • Rice small molecule rnaosa-mir171b gene and its application in increasing rice yield

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0020] It needs to be particularly pointed out that the specific embodiments of the present invention are only used as examples to illustrate how the present invention is realized, and such descriptions cannot form any limitation on the present invention. The scope of the present invention is reflected in the claims. In order to realize the object of the present invention, the following description is made by way of example.

[0021] According to the sequence of osa-miR171b obtained by high-throughput sequencing, the specific sequence information is as follows: 5'UGAUUGAGCCGUGCCAAUAUC 3', (SEQ ID NO: 1), replace the known osa-MIR528 front with this microRNA, osa-miR171b sequence The osa-miR528 sequence in the body sequence was obtained to obtain the artificial miR171b sequence osa-miR171b (SEQ ID NO: 2), wherein, the underlined part in sequence 2 is the corresponding sequence formed by the substitution of sequence 1, and the substitution here is not a simple substitution, but...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses rice small molecule RNA osa-miR171b and its application in regulating rice panicle length and increasing yield. The present invention obtains microRNA osa-miR171b from rice Nipponbare by high-throughput sequencing, and uses the microRNA to construct the sequence of the precursor gene pre-miR528. After the microRNA precursor was overexpressed in rice, osa-miR171b, compared with the wild-type control, the transgenic lines had longer panicles and increased seed setting. Therefore, overexpression of osa‑miR171b in rice is of great significance for improving rice yield, which provides new resources and research methods for high-yield molecular breeding of rice.

Description

Technical field: [0001] The invention relates to the field of plant genetic engineering, in particular to the application of rice small molecule RNA osa-miR171b in rice. Background technique [0002] Small RNAs (microRNAs) are ubiquitous in animals and plants and play an important role in the post-transcriptional regulation of their target genes, thereby regulating the traits of organisms. [0003] Rice (Oryza sativa L.) is an important food crop. In recent years, the successful application of hybrid rice in agricultural production has greatly increased the yield of rice. However, there is a certain limit to increase the yield of rice through hybridization. In order to further improve the yield of rice, the transgenic method provides a new way. Contents of the invention [0004] The team of the present invention found that the overexpression of rice microRNA through transgene can increase the panicle length and the number of seeds to improve rice yield. [0005] On the o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113C12N15/82A01H5/00A01H6/46
CPCC12N15/8205C12N15/8216C12N15/8261C12N2310/141
Inventor 燕飞袁泉佟爱仔彭杰军鲁宇文赵晋平郑红英林林程晔陈剑平
Owner ZHEJIANG ACADEMY OF AGRICULTURE SCIENCES
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More