Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

CRISPR/Cas9-gRNA targeting sequence pair and targeting plasmid of HTT (Huntingtin) and application thereof

A technology of cas9-gRNA and sequence pair, applied in the field of biology, can solve problems such as rare applications

Inactive Publication Date: 2018-07-06
SOUTHWEST UNIVERSITY
View PDF7 Cites 29 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But its application in HTT is relatively rare

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • CRISPR/Cas9-gRNA targeting sequence pair and targeting plasmid of HTT (Huntingtin) and application thereof
  • CRISPR/Cas9-gRNA targeting sequence pair and targeting plasmid of HTT (Huntingtin) and application thereof
  • CRISPR/Cas9-gRNA targeting sequence pair and targeting plasmid of HTT (Huntingtin) and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] This embodiment provides the in vitro activity determination of the CRISPR / Cas9-gRNA targeting sequence of HTT (hereinafter referred to as gRNA). Among them, the inventor designed the following multiple targeting sequences:

[0038] Htt-L1: ccctggaaaagctgatgaagg

[0039] Htt-L2: aagccgtcatggcaaccctgg

[0040] Htt-L3: tcgggcaggaagccgtcatgg

[0041] Htt-L4: gggtctgtcccatcgggcagg

[0042] Htt-L5: ttcagggtctgtcccatcggg

[0043] Htt-L6: gtaggctccaagtcttcaggg

[0044] Htt-R1: gggttgaggcggaggcggcgg

[0045] Htt-R2: agggggttgaggcggaggcgg

[0046] Htt-R3: ctgagggggttgaggcggagg

[0047] Htt-R4: cggctgagggggttgaggcgg

[0048] Htt-R5: cggcggctgagggggttgagg

[0049] Htt-R6: ccctgaggcggcggctgaggg

[0050] In the above sequence, the last three “ngg (n is any base in a / t / c / g)” of each sequence is the PAM sequence.

[0051] 1. In vitro transcription of gRNA

[0052] Use T7-gRNA-FPg and gRNA-RP primer pairs (primer pair sequence is shown in Table 1), polymerase chain reaction (PCR) with standard gRNA fragm...

Embodiment 2

[0082] This embodiment provides a CRISPR / Cas9-gRNA targeting plasmid of HTT and a construction method thereof. The targeting plasmid is obtained by constructing a pair of targeting sequences into a vector plasmid. The targeting sequence pair consists of an L sequence and an R sequence, where the L sequence is selected from any sequence of Htt-L1, Htt-L2, Htt-L4, and Htt-L6 in Example 1. The R sequence is in Example 1. In Htt-R2 or Htt-R6. The vector plasmid is a vector plasmid suitable for mammals and / or mammalian cells. Preferably, the vector plasmid also has a fluorescent marker and a resistance gene.

[0083] In this example, the VK001-06 and VK001-07 plasmids were purchased from Beijing Visunlide Biotechnology Co., Ltd., and the corresponding CRISPR / Cas9 rapid construction kit Cat VK001-06 / 07 was used to construct the targeting plasmid. The linear maps of the targeting plasmid constructed with VK001-06 and VK001-07 as vectors are as follows: Figure 4 As shown, Figure 4 Amo...

Embodiment 3

[0093] This example provides the activity detection of the targeting plasmid constructed in Example 2, and provides an experimental basis for the application of the targeting sequence pair and the targeting plasmid of the present invention.

[0094] 1. Extraction of targeting plasmid

[0095] Take Htt1, Htt2, Htt3, Htt4, Htt5, Htt6 strains, respectively, on the LB selection plate medium containing Amp+ (80μg / mL), streak culture at 37°C for 24h. Pick out single colonies and inoculate them in 3ml of LB liquid medium containing Amp+ (80μg / mL) on a constant temperature air shaker at 37°C. After culturing for 16 hours, follow the SanPrep endotoxin-free plasmid DNA small extraction kit (Sangon Biotech B518161) The instructions extract Htt1, Htt2, Htt3, Htt4, Htt5, Htt6 endotoxin-free plasmids. Measure the concentration of plasmid with a micro nucleic acid quantifier and store it at -20°C.

[0096] 2. Cell recovery, inoculation, plasmid transfection and DNA extraction

[0097] Take out the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a CRISPR / Cas9-gRNA targeting sequence pair and a CRISPR / Cas9-gRNA targeting plasmid of HTT (Huntingtin) and the application thereof, and relates to the technical field of biology. The CRISPR / Cas9-gRNA targeting sequence pair of the HTT comprises an L sequence and a R sequence, wherein the base sequence of the L sequence is shown as a SEQ ID NO.1; the base sequence of the Rsequence is shown as a SEQ ID NO.2 or 3. The CRISPR / Cas9-gRNA targeting plasmid of the HTT comprises a vector plasmid and the targeting sequence pair, wherein the targeting sequence pair is constructed in the vector plasmid. The invention further provides application of the targeting sequence pair to preparation of an HTT gene mutation model. A reliable basis is provided for establishment of an HD(Huntington's Disease) cell model and a transgenic animal model, and development of HD model building and gene therapy is promoted; an experimental foundation is laid for screening of HD treating medicines and HD treating methods.

Description

Technical field [0001] The present invention relates to the field of biotechnology, in particular to a CRISPR / Cas9-gRNA targeting sequence pair, plasmid and application of a C57BL / 6J mouse and a neuron tumor cell line HTT gene derived therefrom. Background technique [0002] Huntington’s Disease (HD) is a rare familial autosomal dominant genetic disease with neurodegeneration. The typical clinical manifestations are involuntary dance-like movements, progressive cognitive dysfunction or dementia and psychiatric symptoms, neuroimaging tests manifested as caudate nucleus and cerebral cortex atrophy. The pathogenesis of HD can be divided into two types: one is proposed based on known pathophysiological changes (before the pathogenic genes of HD were discovered), including excitotoxin lesions and impaired energy metabolism. ) And oxidative stress, etc.; the other is based on research on the gene and its expression product huntingtin (Htt) after the discovery of the HD pathogenic gene...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/85C12N5/10C12N15/11
CPCC12N15/85C12N2800/107C12N2800/80C12N2810/10
Inventor 付彬徐兴然彭怡杨春丽王柏彬吴惠杨丹
Owner SOUTHWEST UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com