A Molecular Marker Associated with Rapeseed Root Surface Area and Its Application
A molecular marker and surface area technology, applied in the fields of molecular biology and genetic breeding, to shorten the breeding cycle, speed up the breeding process, and reduce the workload
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] Acquisition of genomic haplotype regions significantly associated with rapeseed root surface area:
[0025] (1) Collect 280 inbred lines of Brassica napus from various countries in the world as the core related population of rapeseed, collect individual leaves of each line of the related group, extract the total DNA by CTAB method, and use the rapeseed 60K SNP chip to analyze each sample Perform genotype analysis.
[0026] (2) Use the Illumina BeadStudio genotyping software (http: / / www.illumina.com / ) to calculate the marker heterozygous rate (heterozygous rate), missing rate (missing rate) and minimum allele of the population material at each locus Gene frequency (minorallele frequency). The deletion rate ≤ 0.2, the heterozygosity rate ≤ 0.2, the minimum allele frequency > 0.05, and the unique match of the SNP marker in the Brassica napus genome were used as the screening criteria to filter the SNP markers, and finally 23,542 high-quality SNP markers were obtained for ...
Embodiment 2
[0031] Acquisition of a molecular marker primer significantly associated with root surface area:
[0032] (1) Extract the sequence of 100 bp upstream and downstream of the 32340658th base of the rape C08 chromosome, and develop the SNP marker primer S42 according to the primer design principle, the forward primer is S42-F: CGGTTACGTTAATAGTTATCCGAA, the reverse primer is S42-R: TGTAGTTTTCACATCACATTAAGG, The amplified size was 73bp.
[0033] The sequence amplified in Brassica napus 3S1334 is genotype A, and the sequence is as follows:
[0034] CGGTTACGTTAATAGTTATCCGAATATATGGAAATTTATGAATAGAAAAACTATATATGGATAGTACTAAAAGTATTAACCTTAATGTGATGTGAAAAACTACA
[0035] The sequence amplified in Brassica napus 3S1135 is genotype B, and the sequence is as follows:
[0036] CGGTTACGTTAATAGTTATCCGAATATAAAAAATTTATGAATAGAAAAACTATATGGATAGTACTAAAGTATTAACCTTAATGTGATGTGAAAAACTACA
[0037] (2) The high-resolution melting curve (HRM) technology was used to genotype the marker in the rape-associated po...
Embodiment 3
[0039] The application of primers designed based on the 32340658th base of rapeseed C08 chromosome in screening breeding of rapeseed root surface area, the steps are as follows:
[0040] (1) Among the 280 materials, 39 materials with large root surface area (LI et al.2014) and 39 materials with small root surface area (LI et al.2014) were selected after multi-generation self-crossing.
[0041] (2) The distribution of the two genotypes of molecular marker S42 significantly associated with root surface area in 39 materials with large root surface area and 39 materials with small root surface area were checked. The results showed that the genotype of molecular marker S42 was in 39 Of the material with a large root surface area, 33 were A and 6 were B, while among the 39 materials with a small root surface area, 35 were B and only 4 were A (Table 1). In addition, the T-test results showed that the two genotypes A and B detected by the molecular marker S42 had extremely significant...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 

