Supercharge Your Innovation With Domain-Expert AI Agents!

A Molecular Marker Associated with Rapeseed Root Surface Area and Its Application

A molecular marker and surface area technology, applied in the fields of molecular biology and genetic breeding, to shorten the breeding cycle, speed up the breeding process, and reduce the workload

Active Publication Date: 2021-11-30
INST OF OIL CROPS RES CHINESE ACAD OF AGRI SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the cloning of QTL for root morphology in rapeseed has not been reported so far

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A Molecular Marker Associated with Rapeseed Root Surface Area and Its Application
  • A Molecular Marker Associated with Rapeseed Root Surface Area and Its Application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Acquisition of genomic haplotype regions significantly associated with rapeseed root surface area:

[0025] (1) Collect 280 inbred lines of Brassica napus from various countries in the world as the core related population of rapeseed, collect individual leaves of each line of the related group, extract the total DNA by CTAB method, and use the rapeseed 60K SNP chip to analyze each sample Perform genotype analysis.

[0026] (2) Use the Illumina BeadStudio genotyping software (http: / / www.illumina.com / ) to calculate the marker heterozygous rate (heterozygous rate), missing rate (missing rate) and minimum allele of the population material at each locus Gene frequency (minorallele frequency). The deletion rate ≤ 0.2, the heterozygosity rate ≤ 0.2, the minimum allele frequency > 0.05, and the unique match of the SNP marker in the Brassica napus genome were used as the screening criteria to filter the SNP markers, and finally 23,542 high-quality SNP markers were obtained for ...

Embodiment 2

[0031] Acquisition of a molecular marker primer significantly associated with root surface area:

[0032] (1) Extract the sequence of 100 bp upstream and downstream of the 32340658th base of the rape C08 chromosome, and develop the SNP marker primer S42 according to the primer design principle, the forward primer is S42-F: CGGTTACGTTAATAGTTATCCGAA, the reverse primer is S42-R: TGTAGTTTTCACATCACATTAAGG, The amplified size was 73bp.

[0033] The sequence amplified in Brassica napus 3S1334 is genotype A, and the sequence is as follows:

[0034] CGGTTACGTTAATAGTTATCCGAATATATGGAAATTTATGAATAGAAAAACTATATATGGATAGTACTAAAAGTATTAACCTTAATGTGATGTGAAAAACTACA

[0035] The sequence amplified in Brassica napus 3S1135 is genotype B, and the sequence is as follows:

[0036] CGGTTACGTTAATAGTTATCCGAATATAAAAAATTTATGAATAGAAAAACTATATGGATAGTACTAAAGTATTAACCTTAATGTGATGTGAAAAACTACA

[0037] (2) The high-resolution melting curve (HRM) technology was used to genotype the marker in the rape-associated po...

Embodiment 3

[0039] The application of primers designed based on the 32340658th base of rapeseed C08 chromosome in screening breeding of rapeseed root surface area, the steps are as follows:

[0040] (1) Among the 280 materials, 39 materials with large root surface area (LI et al.2014) and 39 materials with small root surface area (LI et al.2014) were selected after multi-generation self-crossing.

[0041] (2) The distribution of the two genotypes of molecular marker S42 significantly associated with root surface area in 39 materials with large root surface area and 39 materials with small root surface area were checked. The results showed that the genotype of molecular marker S42 was in 39 Of the material with a large root surface area, 33 were A and 6 were B, while among the 39 materials with a small root surface area, 35 were B and only 4 were A (Table 1). In addition, the T-test results showed that the two genotypes A and B detected by the molecular marker S42 had extremely significant...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a molecular marker associated with the surface area of ​​rapeseed root and its application. The present invention obtains for the first time the genomic haplotype region significantly associated with the root surface area of ​​rapeseed, which is located between the 32,337,226th base and the 32,365,749th base of the rapeseed C08 chromosome, and the SNP (single nucleotide polynucleotide) located at the 32340658th base morphological) markers had the highest level of significance and could explain 15.76% of the phenotypic variation. The primers designed according to the molecular markers are S42‑F: CGGTTACGTTAATAGTTATCCGAA, S42‑R: TGTAGTTTTCACATCACATTAAGG. By checking the molecular marker S42 that is significantly associated with the root surface area of ​​rapeseed, the size of the root surface area of ​​rapeseed can be predicted, and then the excellent individual plants with large root surface area can be quickly and accurately screened.

Description

technical field [0001] The invention belongs to the technical field of molecular biology and genetic breeding, and in particular relates to a genome haplotype region significantly associated with the root surface area of ​​Brassica napus, and a molecular marker significantly associated with the root surface area of ​​Brassica napus developed based on this and its application . Background technique [0002] In recent years, the self-sufficiency rate of domestic vegetable oil in my country is only about 35%, which seriously threatens the security of edible oil supply in my country (Hua Wei et al., 2016). Rapeseed is the largest oil crop in my country (Hu et al., 2016), and rapeseed oil is the largest source of domestic edible vegetable oil. However, compared with Canada and other rapeseed exporting countries, my country's rapeseed industry has the problem of low oil production, which restricts its international competitiveness. In the situation where the scale of urbanizatio...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6895
CPCC12Q1/6895C12Q2600/13
Inventor 王汉中顿小玲王杰刘贵华王新发
Owner INST OF OIL CROPS RES CHINESE ACAD OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More