Construction of strain not producing aflatoxin and method for preventing and controlling Aspergillus flavus contamination

A technology of aflatoxins and strains of Aspergillus flavus, applied in the field of microbiology, can solve the problems of Aspergillus flavus pathogenicity being affected and unknown, and achieve the effects of huge economic and social benefits, cost reduction, and pollution control.

Inactive Publication Date: 2018-09-14
FUJIAN AGRI & FORESTRY UNIV
View PDF4 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There is no research report on the Rum1 transcription factor in Aspergillus flavus, so it is unknown whether Rum1 has an effect on the pathogenicity of Aspergillus flavus

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction of strain not producing aflatoxin and method for preventing and controlling Aspergillus flavus contamination
  • Construction of strain not producing aflatoxin and method for preventing and controlling Aspergillus flavus contamination
  • Construction of strain not producing aflatoxin and method for preventing and controlling Aspergillus flavus contamination

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Embodiment 1, in Aspergillus flavus Aflrum1 gene knockout

[0050] Aspergillus flavus Aflrum1 Gene function in Aspergillus flavus morphogenesis and virulence expression, first knockout in Aspergillus flavus Aflrum1 Gene.

[0051] figure 1 A shows the gene knockout strategy and restriction map. in vitro construction Aflrum1 Gene knockout fragments, through the method of homologous recombination, the chromosome Aflrum1 The 3.5 kb DNA fragment in the gene was used pyrG replacement, thereby knocking out the chromosomal Aflrum1 Gene.

[0052] The specific method is as follows:

[0053] Using the 5' primer GGCACGAGCTATTAGTGATATTAGTCGAGTCCGA (SEQ ID NO: 3); and the 3' primer CAAGTGAGCCGACCGATTGAGGGAAGTAGT (SEQ ID NO: 4); the upstream fragment of about 1.2 kb was amplified by PCR from the genomic DNA of Aspergillus flavus CA14 strain;

[0054] Using the 5' primer ACTACTTCCCTCAATCGGTCGGCTCACTT GGCCTCAAACAATGCTCTTCACCC (SEQ ID NO: 5); and the 3' primer GAACCCATG...

Embodiment 2

[0057] Embodiment 2, Aflrum1 The Effect of Gene Knockout on Sporulation of Aspergillus flavus

[0058] Knockout in Aspergillus flavus by homologous recombination Aflrum1 Gene, Southern blot analysis confirmed that the knockout was successful. to detect Aflrum1 Whether the deletion of the gene will affect the spore production of Aspergillus flavus, the inoculation concentration on the PDA medium is 10 6 1 μl of spore solution per ml, and placed at 37°C ( figure 2 A, 2B), 29°C ( figure 2 C, 2D) Cultivate under dark conditions for 5 days, and observe the sporulation of the following strains. The wild-type strain WT produced a large number of green spores, while Aflrum1 The number of green spores produced by the deletion strain was much higher than that of the WT, and the statistical analysis of the data also showed this point.

[0059] This result shows that, Aflrum1 Gene deletion affects sporulation in Aspergillus flavus.

Embodiment 3

[0060]Embodiment 3, Aflrum1 Effect of gene knockout on toxin production of Aspergillus flavus

[0061] to detect Aflrum1 Whether the deletion of the gene will affect the toxin production of Aspergillus flavus, inoculate the spores in the YES liquid medium to a final concentration of 10 6 cells / ml, cultured statically for 6 days under continuous dark conditions at 29°C, extracted the toxin, and analyzed the toxin production of each strain by TLC. The results showed that the WT strain produced a large amount of aflatoxins AFB1 and AFB2, while ⊿ Aflrum1 AFB1 and AFB2 are obviously not produced, and the statistical analysis of the data also shows this ( image 3 A, 3B).

[0062] Simultaneous detection of aflatoxin biosynthesis pathway regulatory genes by qRT-PCR wxya and wxya , and some structural genes wxya and wxya the transcription level of actin As an internal control for transcriptional analysis. Compared with the WT strain, ⊿ Aflrum1 The transcription lev...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a construction method of a strain not producing aflatoxin and a method for preventing and controlling Aspergillus flavus contamination, wherein the Aspergillus flavus in an avirulent strain does not express pathogenicity-related gene Aflrum1, and the strain is non-toxic, produces no sclerotia and has high sporulation and low pathogenicity. Based on the above characteristicsof the strain, the method for preventing and controlling the Aspergillus flavus by using the strain is further disclosed. More specifically, the method includes the step that with the characteristicsof the non-toxicity, non-bacterial nucleus, high sporulation and low pathogenicity of the strain of Aspergillus flavus used, the strain competes with a wild-produced strain of Aspergillus flavus for alimited niche in a susceptible area of Aspergillus flavus, such as main peanut producing areas. Consequently, the method for preventing and controlling the Aspergillus flavus contamination has the advantages of effectively reducing the density of the wild-produced strains of Aspergillus flavus, effectively controlling and reducing contamination of aflatoxins from crops and aspergillosis infectioninduced thereby.

Description

technical field [0001] The invention belongs to the field of microbiology, and in particular relates to the construction of a non-aflatoxin-producing bacterial strain and a method for preventing and controlling aflatoxin pollution. Background technique [0002] Aspergillus flavus ( Aspergillus flavus ) is an important plant pathogenic fungus widely distributed in nature. Aspergillus flavus is also a zoonotic pathogen, which can grow and reproduce parasitically in grain, food and feed, and produce aflatoxin, among which aflatoxin B1 (Aflatoxin B1, AFB1) is the most harmful and is the most harmful toxin found so far. One of the most carcinogenic and toxic natural pollutants. According to the report of the Food and Agriculture Organization of the United Nations (FOA), about 25% of the world's crops are polluted by fungi and mycotoxins every year, causing economic losses of hundreds of billions of dollars. AFB1 is 68 times more toxic than arsenic and 10 times more toxic than ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/15C12N15/90A23L5/20C12R1/67
CPCA23L5/28C07K14/38C12N15/902
Inventor庄振宏胡育乐汪世华袁军张峰刘亚举郭志强
OwnerFUJIAN AGRI & FORESTRY UNIV