PpCER1-2 gene, vector and application of PpCER1-2 gene in improvement of drought resistance of gramineous plants
A gene and carrier technology, applied in the field of plant breeding, can solve problems such as hindering plant drought resistance, lack, and lack of grass cuticle, and achieve the effects of improving plant drought resistance, slowing water loss, and enhancing crop yield reduction.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0026] In order to make the object, technical solution and advantages of the present invention more clear, the present invention will be further described in detail below in conjunction with the examples. It should be understood that the specific embodiments described here are only used to explain the present invention, not to limit the present invention.
[0027] The application principle of the present invention will be described in detail below in conjunction with the accompanying drawings.
[0028] The sequence of the PpCER1-2 gene provided in the embodiment of the present invention is: SEQ ID NO:1.
[0029] Such as figure 1 As shown, the construction method of the PpCER1-2 gene provided by the embodiments of the present invention includes the following steps:
[0030] S101: According to the bluegrass leaf transcriptome data, design the upstream primer: ATGGCGACCAGGCCGGG (SEQ ID NO: 2), the downstream primer: TCAAGCTTTCGTCAGAGGGACGA (SEQ ID NO: 3), and use the first stra...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


