Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A diagnostic gene for idiopathic basal calcification and its detection method

A basal ganglia calcification, idiopathic technique, applied in biochemical equipment and methods, microbial determination/testing, DNA/RNA fragments, etc.

Active Publication Date: 2022-05-03
黄远桃 +1
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The present invention provides a diagnostic gene for idiopathic basal calcification and a detection method thereof, aiming to solve the defects of existing methods for diagnosing idiopathic basal calcification

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A diagnostic gene for idiopathic basal calcification and its detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] By summarizing the clinical characteristics of a large sample of IBGC, the pathogenic gene and locus of IBGC disease were discovered through whole-genome exome sequencing and functional verification. The nucleotide sequence of the SLC20A2 gene is shown in SEQ ID NO 1. The pathogenic site is located at c.730+1G>A site 2 of the SLC20A2 gene.

Embodiment 2

[0027] For the c.730+1G>A site 2 of the SLC20A2 gene, F: CTCATGGCAACTGGGACCTT; R: GTGGGCCATAGCCCTCATTT were used as primers to detect the pathogenic site, and a portable kit containing these two primers was designed for clinical convenience Diagnose the patient.

Embodiment 3

[0029] For the SLC20A2 gene and c.730+1G>A site 2, use primers F: CTCATGGCAACTGGGACCTT; R: GTGGGCCATAGCCCTCATTT for PCR amplification and sanger sequencing. If the blood DNA of the patient can detect the pattern change, IBGC patients can be diagnosed .

[0030] The specific detection method includes the following steps:

[0031] S1. Take the patient's peripheral blood and extract DNA;

[0032] S2. Find the c.730+1G>A site 2 of the SLC20A2 gene in the DNA, use primers F: CTCATGGCAACTGGGACCTT, R: GTGGGCCATAGCCCTCATTT for PCR amplification and sanger sequencing, and obtain the detection results;

[0033] S3. Analyze the spectrum of the test results. If there is a peak in the spectrum that changes into a towering double peak, that is, a heterozygous mutation occurs in the DNA of the confirmed patient, and the patient is a patient with idiopathic basal calcification.

[0034] The step S2 further includes S21. The c.730+1G>A site 2 of the SLC20A2 gene is found through whole-genome...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a diagnostic gene for idiopathic basal calcification, and by finding the causative site of the diagnostic gene, a diagnostic method for detecting the causative site by using primers is provided. The invention quickly and accurately diagnoses IBGC patients clinically discovered by doctors through head imaging data; performs prenatal detection and diagnosis on family members of IBGC who have not yet developed a disease and their next generation, early detection of patients and avoidance of children carrying disease-causing genes The birth; provide the basis for the early treatment and prevention of IBGC.

Description

technical field [0001] The invention relates to a human body variation gene, in particular to a diagnostic gene for idiopathic basal calcification and a detection method thereof. Background technique [0002] At present, if a clinician finds that the patient has calcification of the basal ganglia in the brain tissue or other parts of the brain tissue through the imaging data of the head in clinical work, the patient's blood indicators are usually further tested: blood routine, erythrocyte sedimentation rate, liver and kidney function, electrolytes , syphilis, anti-Sm and antinuclear antibodies, trace elements, parathyroid hormone and calcitonin, etc. for further clinical diagnosis. On the one hand, the existing technology is time-consuming and laborious to diagnose patients and may not be able to make a clear diagnosis. In addition, because IBGC is a genetic disease, family members have a 50% chance of getting the disease, and the formation of brain tissue calcified lesions ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6883C12N15/11
CPCC12Q1/6883C12Q2600/156
Inventor 黄远桃周宏灏
Owner 黄远桃
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More