A diagnostic gene for idiopathic basal calcification and its detection method
A basal ganglia calcification, idiopathic technique, applied in biochemical equipment and methods, microbial determination/testing, DNA/RNA fragments, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] By summarizing the clinical characteristics of a large sample of IBGC, the pathogenic gene and locus of IBGC disease were discovered through whole-genome exome sequencing and functional verification. The nucleotide sequence of the SLC20A2 gene is shown in SEQ ID NO 1. The pathogenic site is located at c.730+1G>A site 2 of the SLC20A2 gene.
Embodiment 2
[0027] For the c.730+1G>A site 2 of the SLC20A2 gene, F: CTCATGGCAACTGGGACCTT; R: GTGGGCCATAGCCCTCATTT were used as primers to detect the pathogenic site, and a portable kit containing these two primers was designed for clinical convenience Diagnose the patient.
Embodiment 3
[0029] For the SLC20A2 gene and c.730+1G>A site 2, use primers F: CTCATGGCAACTGGGACCTT; R: GTGGGCCATAGCCCTCATTT for PCR amplification and sanger sequencing. If the blood DNA of the patient can detect the pattern change, IBGC patients can be diagnosed .
[0030] The specific detection method includes the following steps:
[0031] S1. Take the patient's peripheral blood and extract DNA;
[0032] S2. Find the c.730+1G>A site 2 of the SLC20A2 gene in the DNA, use primers F: CTCATGGCAACTGGGACCTT, R: GTGGGCCATAGCCCTCATTT for PCR amplification and sanger sequencing, and obtain the detection results;
[0033] S3. Analyze the spectrum of the test results. If there is a peak in the spectrum that changes into a towering double peak, that is, a heterozygous mutation occurs in the DNA of the confirmed patient, and the patient is a patient with idiopathic basal calcification.
[0034] The step S2 further includes S21. The c.730+1G>A site 2 of the SLC20A2 gene is found through whole-genome...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com