Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

FRET (fluorescence resonance energy transfer)-based PCR (polymerase chain reaction) homogeneous phase detection system and application thereof

A detection system and technology of labeling groups, which are used in the determination/inspection of microorganisms, biochemical equipment and methods, etc., can solve problems such as inapplicability to real-time fluorescent SNP typing

Pending Publication Date: 2018-10-30
王卫东
View PDF10 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] In view of the shortcomings of the prior art described above, the purpose of the present invention is to provide a FRET-based PCR homogeneous detection system and its application, which is used to solve the problem of the need for seven oligonucleotides in the detection of SNP sites by the Kasp method in the prior art. , and mainly end-point SNP typing, not suitable for real-time fluorescence SNP typing and other issues

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • FRET (fluorescence resonance energy transfer)-based PCR (polymerase chain reaction) homogeneous phase detection system and application thereof
  • FRET (fluorescence resonance energy transfer)-based PCR (polymerase chain reaction) homogeneous phase detection system and application thereof
  • FRET (fluorescence resonance energy transfer)-based PCR (polymerase chain reaction) homogeneous phase detection system and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] A single set of fluorescent primer amplification experiments, this example detects the insertion of the constructed plasmid into the human gene

[0049] Table 1 Primer sequence list

[0050]

[0051]

[0052] The bases at both ends of the mutation site R (R=A / G) were intercepted with a total of 300bp, and two plasmids were synthesized for these two bases: rs662-A and rs662-G, which were used as the standard quality control for the control of this experiment. Spectrum such as image 3 and Figure 4 shown. The vector is provided by Shanghai Xuguan Biotechnology Development Co., Ltd., cloning vector: PES, resistance: Ampicillin, insertion site: EcoRV, strain: DH5α, and its sequence is shown in SEQ ID NO.5.

[0053] The rs662-A DNA sequence is as follows:

[0054] TAATAATCCTGTAATGTTCAATACCTTCACCTTATATATTATGTGTGTATGTTTTAATTGCAGTTTGAATGATATTGTTGCTGTGGGACCTGAGCACTTTTATGGCACAAATGATCACTATTTTCTTGACCCCTACTTACAATCCTGGGAGATGTATTTGGGTTTAGCGTGGTCGTATGTTGTCTACTATAGTCCAAGTGAAG...

Embodiment 2

[0067] SNP detection for rs662 locus

[0068] The primer sequences are shown in Table 4 below.

[0069] Table 4 Primer sequence list

[0070]

[0071] In this embodiment, the human leukocyte gene is detected, and the reaction system is shown in Table 5 below:

[0072] Table 5 The composition of the reaction system when detecting human leukocyte genes

[0073]

[0074]

[0075] The PCR reaction program was as follows: pre-denaturation at 95°C for 60s, denaturation at 95°C for 15s, annealing at 56°C for 30s, 50 cycles.

[0076] Image 6 Shown as the amplification curve of the double fluorescent primer set of plasmid GG on the fluorescent quantitative PCR instrument. The blue curve corresponding to FAM is very high, and the green curve corresponding to HEX is very low. It can be seen that only FAM has obvious amplification, which belongs to GG type and can be classified.

[0077] Figure 7 Shown as the amplification curve of the double fluorescent primer set of pla...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an FRET (fluorescence resonance energy transfer)-based PCR (polymerase chain reaction) homogeneous phase detection system and an application thereof. The PCR homogeneous phase detection system comprises at least one fluorescence or quenching labeled chimeric primer connected with a tag sequence, namely, a primer capable of starting DNA (deoxyribonucleic acid) synthesis, a quenching or fluorescence labeled oligonucleotide sequence and a reverse amplification primer, wherein the oligonucleotide sequence complements the tag sequence. Signals can be timely observed by a fluorescent quantitative PCR instrument.

Description

technical field [0001] The invention relates to the field of gene detection, in particular to a FRET-based PCR homogeneous detection system and its application. Background technique [0002] SNP testing is currently the most demanding genetic testing. SNP typing methods can be described in various forms, but with the continuous emergence of new technologies, methods and instruments, some methods are no longer used, or are only used for auxiliary verification, and some methods are very sophisticated, but not suitable for large-scale use. [0003] Single nucleotide polymorphism refers to the polymorphism of DNA sequence caused by the change of a single base in the genome. Mainly refers to conversion and transversion, including very few insertions or deletions. SNP is the most common genetic variation, accounting for more than 90% of known polymorphisms, and exists widely in the human genome. Due to its wide distribution and stable genetic characteristics, many disease susce...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6858
CPCC12Q1/6858C12Q2535/137C12Q2563/107C12Q2545/114C12Q2531/113
Inventor 王卫东钟京毛赟赟李京励
Owner 王卫东
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com