Check patentability & draft patents in minutes with Patsnap Eureka AI!

Expression vector for delivering fused RNA binding protein and preparation method and application thereof

A technology that combines proteins and expression vectors, applied in the field of molecular biology, can solve the problems of limited delivery methods and intervention methods, and achieve the effect of interfering in the gene expression of macrophages

Inactive Publication Date: 2018-11-06
FOURTH MILITARY MEDICAL UNIVERSITY
View PDF3 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This type of RNA-binding protein is an ideal drug target, but the means of delivery and intervention are very limited, and how to target and interfere with its function has become a bottleneck

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Expression vector for delivering fused RNA binding protein and preparation method and application thereof
  • Expression vector for delivering fused RNA binding protein and preparation method and application thereof
  • Expression vector for delivering fused RNA binding protein and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1: Construction of RNA-binding protein Lamp2b-HuR exosomes

[0037] The specific steps to build are as follows:

[0038] (1) Trizol extracts total RNA from mouse fibroblasts;

[0039] (2) Using Promega M-MLV reverse transcriptase to reverse transcribe RNA to obtain mouse fibroblast cDNA;

[0040] The reaction system is shown in Table 1:

[0041] Table 1 reaction system

[0042] RNA template

2μg

5×RT buffer

4μl

dNTP Mixture (10mM)

2μl

0.1M DTT

2μl

M-MLV reverse transcriptase

1μl

overall system

20μl

[0043] Mix the above reagents, centrifuge at a low speed for a short time, place in a 37°C incubator for 1 to 2 hours, and store at -20°C.

[0044] (3) Using the reverse transcription cDNA as a template to amplify the target band;

[0045] The primers and PCR reaction system are shown in Table 2 and Table 3:

[0046] Table 2 Reaction Primers

[0047] Primer name

Primer sequen...

Embodiment 2

[0065] Example 2: Construction of RNA-binding protein HuR-Lamp2b exosomes

[0066] (1) Reverse transcription of cDNA is the same as in Example 1.

[0067] (2) Using the reverse transcription cDNA as a template to amplify the target band;

[0068] Primers and PCR conditions are shown in Table 5 and Table 6:

[0069] Table 5 PCR primers

[0070] Primer name

Primer sequence

Lamp2b F

ATCCGCTAGCGGTCGCCACCATGTGCCTCTCTCCGGTT

Lamp2b R

ATCCGGATCCGTGTTACAGAGTCTGATATCC

f

GCC GGATCC ATGTCTAATGGTTATGAAGAC

R

CCC GAATTC TTA TTTGTGGGACTTGTTGGTTTTGAAG

[0071] Table 6 PCR reaction system

[0072]

[0073]

[0074] The reaction conditions are as follows: pre-denaturation, 95°C for 3min; cycle, 95°C for 15s, 58°C for 15s, 72°C for 30s-2min (depending on the length of the product), 30 cycles in total.

[0075] (3) Clone:

[0076] First, the PCR products of primers Lamp2b F and Lamp2b R were connected into the pcDNA3.1 vector...

Embodiment 3

[0087] Example 3: Verification test of physicochemical properties of modified exosomes

[0088] The two fusion expression vectors constructed in Example 1 and Example 2 were respectively transfected with the packaging plasmid into the exosome packaging cell HEK293T at the same time to obtain virus particles expressing the fusion protein. Infect exosome packaging cells with the virus, such as bone marrow mesenchymal cells MSC, and then culture them under serum-free conditions, collect exosomes between 48 and 72 hours, and extract exosomes through the exosome isolation and extraction kit ExoQuick . Identify the number, size, and fusion expression efficiency of exosomes.

[0089] The specific methods and results are as follows:

[0090] The collected exosomes were diluted 1:1000 with PBS, and then the number and size of exosomes were identified by Nanosight (such as image 3 As shown), the particle sizes of the three exosomes were found to be similar, all in the range of 50–20...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an expression vector for delivering a fused RNA binding protein, provides a preparation method of the vector and also designs an exosome containing the expression vector for delivering the fused RNA binding protein. The expression vector includes a guiding protein sequence and an RNA binding protein sequence. The guiding protein can be localized in an exosome and / or a lysosome. The RNA binding sequence comprises an RNA binding protein complete sequence or an RNA binding protein structural domain sequence. The preparation method of the vector comprises the steps that thevector and a packaging plasmid jointly co-transfect with an HEK293T cell packaging virus, a virus infection exosome packages cells, and the exosome is collected. The expression vector or the exosomeis applied to treatment of relevant diseases regulated and controlled by a drug delivery vector and RNA. The exosome is selected as a means for delivering the RNA binding protein, and an efficient method for delivering the modified fused RNA binding protein is created.

Description

technical field [0001] The invention relates to the technical field of molecular biology, in particular to an expression vector for delivering a fusion RNA binding protein, a preparation method and application thereof. Background technique [0002] The proportion of protein drugs in the medical field is increasing, and the targeted delivery of protein drugs, especially protein drugs in tissues and cells, is the most important link in the application of protein drugs. [0003] At present, the delivery methods of protein drugs include: solving the problem of transcellular delivery through protein fusion membrane penetrating peptide, using microspheres or hydrogels to solve the problem of protein sustained release, and using targeted nanoparticles or nanogels to solve the problem of tissue and Cell targeting issues. However, the mechanisms of these means are complex and difficult to regulate. [0004] In recent years, exosomes have received more and more attention as a means ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/85C12N15/62C12N15/66C12N5/10A61K47/46
CPCA61K47/46C07K14/00C07K2319/06C12N15/85
Inventor 袁丽君李者龙杨国栋周雪莹赵联璧
Owner FOURTH MILITARY MEDICAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com