Application of non-coding RNA molecule Lnc-DC in predicting drug resistance of tamoxifen in breast cancer
A technology of tamoxifen and lnc-dc, applied in the direction of DNA/RNA fragments, recombinant DNA technology, microbial measurement/inspection, etc., to achieve great clinical application value
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0046] 1. MCF-7 cells were transfected by the CRISPR / Cas9-SAM library system, and then MCF-7 cells with high expression of Lnc-DC were screened out in a hormone-independent growth environment (called MCF-7 Lnc-DC+ cell).
[0047] According to www.lncrandb.org and www.cuilab.cn / lncrnadisease, the inventors designed gRNA (guide RNA, 5 gRNAs for each LncRNA) for 241 reported LncRNAs, and MCF- 7 cells were transfected to increase the expression level of Lnc-RNA. After the transfected cells were cultured in an estrogen-free medium, only a small amount of cells survived. The inventors detected the RT-PCR of gRNA on the surviving cells and found that in Lnc-DCs gRNA1aggacccagggtacacaggg (SEQ ID NO.12); Lnc- DC sgRNA2gagctggaatgcaaggccag (SEQ ID NO.13); Lnc-DC sgRNA3gctgtgagtgactgagaaaa (SEQ ID NO.14); Lnc-DCsgRNA4gtcagaggagggcgttccct (SEQ ID NO.15); Lnc-DC sgRNA5aggtaatgtagaaggaccca (SEQ ID NO.16) -DC expression rises most obviously, surviving cells become MCF-7 lnc-DC+ cell.
[...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com