Check patentability & draft patents in minutes with Patsnap Eureka AI!

Application of non-coding RNA molecule Lnc-DC in predicting drug resistance of tamoxifen in breast cancer

A technology of tamoxifen and lnc-dc, applied in the direction of DNA/RNA fragments, recombinant DNA technology, microbial measurement/inspection, etc., to achieve great clinical application value

Active Publication Date: 2018-11-06
ZHEJIANG PROVINCIAL PEOPLES HOSPITAL
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

About 30% of breast cancer patients have primary drug resistance to tamoxifen, and some patients are effective in the initial treatment but then develop acquired drug resistance, but there is no effective biomarker for predicting tamoxifen. Suifen sensitivity may be used for targeted therapy to reverse drug resistance

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of non-coding RNA molecule Lnc-DC in predicting drug resistance of tamoxifen in breast cancer
  • Application of non-coding RNA molecule Lnc-DC in predicting drug resistance of tamoxifen in breast cancer
  • Application of non-coding RNA molecule Lnc-DC in predicting drug resistance of tamoxifen in breast cancer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0046] 1. MCF-7 cells were transfected by the CRISPR / Cas9-SAM library system, and then MCF-7 cells with high expression of Lnc-DC were screened out in a hormone-independent growth environment (called MCF-7 Lnc-DC+ cell).

[0047] According to www.lncrandb.org and www.cuilab.cn / lncrnadisease, the inventors designed gRNA (guide RNA, 5 gRNAs for each LncRNA) for 241 reported LncRNAs, and MCF- 7 cells were transfected to increase the expression level of Lnc-RNA. After the transfected cells were cultured in an estrogen-free medium, only a small amount of cells survived. The inventors detected the RT-PCR of gRNA on the surviving cells and found that in Lnc-DCs gRNA1aggacccagggtacacaggg (SEQ ID NO.12); Lnc- DC sgRNA2gagctggaatgcaaggccag (SEQ ID NO.13); Lnc-DC sgRNA3gctgtgagtgactgagaaaa (SEQ ID NO.14); Lnc-DCsgRNA4gtcagaggagggcgttccct (SEQ ID NO.15); Lnc-DC sgRNA5aggtaatgtagaaggaccca (SEQ ID NO.16) -DC expression rises most obviously, surviving cells become MCF-7 lnc-DC+ cell.

[...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of non-coding RNA molecule Lnc-DC in predicting drug resistance of tamoxifen in breast cancer as well as application of non-coding Lnc-RNA molecule Lnc-DC in preparing a detection agent for predicting the drug resistance of the tamoxifen in the breast cancer. The nucleotide sequence of the Lnc-DC is shown as SEQ ID NO.1. The invention also discloses primers or aprobe for predicting the drug resistance of the tamoxifen in the breast cancer and a method for improving the effect of predicting the tamoxifen for the breast cancer. The method comprises the stepsof administrating breast cancer patients with the tamoxifen and an Lnc-RNA molecule Lnc-DC inhibitor as well as a medicinal composition containing the tamoxifen and the Lnc-RNA molecule Lnc-DC inhibitor.

Description

technical field [0001] The invention belongs to the field of tumor biological treatment, and relates to the application of a non-coding RNA molecule lnc-DC in predicting tamoxifen drug resistance of breast cancer. Background technique [0002] Breast cancer is currently the most common malignancy in women worldwide. The mammary gland is an important hormone-targeting organ in the human body. 70% of breast cancers express estrogen receptor (Estrogen Receptor, ER) or progesterone receptor (Progesterone Receptor, PR) in the malignant tumors of the mammary gland, and this type of breast cancer It is sensitive to hormone suppression therapy and has indications for endocrine therapy. Tamoxifen (TAM) is a non-steroidal anti-estrogen drug, which is currently the first-line drug for endocrine therapy of breast cancer in premenopausal women, and plays a very important role. [0003] Although it has been clinically observed that tamoxifen has definite efficacy and minor side effects ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6886C12N15/113
Inventor 杨柳倪超胡晓歌莫寅元
Owner ZHEJIANG PROVINCIAL PEOPLES HOSPITAL
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More