Unlock instant, AI-driven research and patent intelligence for your innovation.

Construction of high-copy and high-expression recombinant plasmid and its application in exogenous gene expression

A recombinant plasmid and high-expression technology, applied in the field of genetic engineering, to achieve broad market prospects, time-saving recombination, and high-yield effects

Active Publication Date: 2021-08-13
安徽朵能生物科技有限公司
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is no related plasmid vector in the domestic market
In addition, we tested and found that the vector constructed according to the literature has leaked expression

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction of high-copy and high-expression recombinant plasmid and its application in exogenous gene expression
  • Construction of high-copy and high-expression recombinant plasmid and its application in exogenous gene expression
  • Construction of high-copy and high-expression recombinant plasmid and its application in exogenous gene expression

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1: Construction of recombinant plasmid DN-001

[0041] High-copy and high-expression recombinant plasmid DN-001 consists of pUC ori replication promoter, Ampicillin resistance gene, cymR gene, T5 promoter, cym-cmt operator, multiple cloning site and His tag; figure 1 Shown is the plasmid map of this plasmid DN-001.

[0042] The construction of high-copy and high-expression recombinant plasmid DN-001 includes the following steps:

[0043] SS01 uses the plasmid pcDNA3.1(-) as a template, PCR amplifies the fragment pUC-Amp containing the pUC ori replication promoter and the Ampicillin resistance gene,

[0044] The designed primers are:

[0045] pcDNA-5:TCGACCTCTAGCTAGAGCTT

[0046] pcDNA-3:TATATGGGCTATGAACTAA

[0047] Using the plasmid pcDNA3.1(-) as a template, PCR amplification was carried out with the above two primers, and a DNA fragment pUC-Amp of about 2400bp composed of the pUC ori replication promoter and the Ampicillin resistance gene was amplified, wh...

Embodiment 2

[0058] Example 2: Construction of recombinant plasmids expressing foreign genes

[0059] Figure 4 It is the expression yield diagram of DN-001-CKAP1 and DN-001-ACTB in Escherichia coli BL21(DE3).

[0060] Digest the DNA fragments of exogenous genes (such as Trypsin, EcoRI, CRIPT, ACT B, etc. but not limited to the above-mentioned genes) and DN-001 with Nco I and Xho I. After the kit is purified and recovered, use T4 DNA ligase at 16°C Ligate overnight, transform Escherichia coli DH5α, and extract the recombinant plasmid with a plasmid extraction kit. The correct DN-001 exogenous gene expression plasmid was screened out by restriction enzyme digestion and sequencing. As a control, the exogenous gene was also cloned into the pET-28a vector using Nco I and Xho I sites to construct the pET-28a exogenous gene expression plasmid.

Embodiment 3

[0061] Example 3: Induced expression of exogenous genes

[0062] The constructed recombinant plasmid was transformed into BL21(DE3), and a single clone was picked and inoculated into LB liquid medium containing ampicillin sodium (final concentration: 50 μg / ml), and cultured overnight at 37°C with shaking. On the next day, insert the overnight activated bacterial solution into fresh LB-resistant medium at a ratio of 1:200, expand the culture, and culture on a shaking table at 37°C for 3 hours. Divide the bacterial solution into two groups, one is the induction group, and the other is the induction group. One group was the control group; the induction group was added with IPTG to a final concentration of 1 mmol / L, and cultured on a shaker at 37°C for 4 hours. At the end of the induction, the induction group and the control group were centrifuged at 8500rpm for 2min, the supernatant was removed as much as possible, 1×SDS-PAGE loadingBuffer was added, boiled at 95°C for 5 minutes,...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses the construction of a high-copy and high-expression recombinant plasmid and its application in exogenous gene expression, and relates to the technical field of genetic engineering. In the present invention, the pcDNA3.1(-) plasmid is used as the backbone, and the cumate-cymR inducible expression regulatory unit is loaded between the pUC ori high-copy replicon and the Ampicillin resistance gene, and at the same time, the multiple cloning site downstream of the pET-28a T7 promoter Point, 6xHis coding sequence and T7 transcription termination sequence were inserted downstream of the cumate-cymR regulatory unit to construct a recombinant plasmid DN-001 with high replication and high expression. The recombinant plasmid DN‑001 of the present invention has the advantages of being the most economical, the most convenient, and high yield, making the recombination of gene expression vectors time-saving and labor-saving; it can be applied to the production of large doses of recombinant proteins; at the same time, it effectively suppresses leaky expression, making This vector is especially suitable for the expression of toxic proteins, which makes this vector have broad market prospects.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a high-copy and high-expression recombination plasmid transformed by a genetic engineering method, and the application of the recombination plasmid in exogenous gene expression. Background technique [0002] The prokaryotic gene expression system is the most economical, convenient and widely used recombinant gene expression system, including the expression of His-tagged recombinant proteins (existing literature: Rosano GL, Ceccarelli EA. Recombinant protein expression in Escherichia coli: advances and challenges. Front Microbiol .2014Apr 17;5:172; Wingfield PT.Overview of the purification of recombinant proteins.Curr Protoc Protein Sci.2015Apr 1;80:6.1.1-35 has relevant instructions). The His tag is composed of 6 histidines, which has small molecular weight, poor immunogenicity, and does not change the spatial structure and solubility of the protein; using...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/70C12N15/66C12P21/00
CPCC12N15/66C12N15/70C12P21/00
Inventor 蔡春林徐雪姣
Owner 安徽朵能生物科技有限公司