Construction of high-copy and high-expression recombinant plasmid and its application in exogenous gene expression
A recombinant plasmid and high-expression technology, applied in the field of genetic engineering, to achieve broad market prospects, time-saving recombination, and high-yield effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] Example 1: Construction of recombinant plasmid DN-001
[0041] High-copy and high-expression recombinant plasmid DN-001 consists of pUC ori replication promoter, Ampicillin resistance gene, cymR gene, T5 promoter, cym-cmt operator, multiple cloning site and His tag; figure 1 Shown is the plasmid map of this plasmid DN-001.
[0042] The construction of high-copy and high-expression recombinant plasmid DN-001 includes the following steps:
[0043] SS01 uses the plasmid pcDNA3.1(-) as a template, PCR amplifies the fragment pUC-Amp containing the pUC ori replication promoter and the Ampicillin resistance gene,
[0044] The designed primers are:
[0045] pcDNA-5:TCGACCTCTAGCTAGAGCTT
[0046] pcDNA-3:TATATGGGCTATGAACTAA
[0047] Using the plasmid pcDNA3.1(-) as a template, PCR amplification was carried out with the above two primers, and a DNA fragment pUC-Amp of about 2400bp composed of the pUC ori replication promoter and the Ampicillin resistance gene was amplified, wh...
Embodiment 2
[0058] Example 2: Construction of recombinant plasmids expressing foreign genes
[0059] Figure 4 It is the expression yield diagram of DN-001-CKAP1 and DN-001-ACTB in Escherichia coli BL21(DE3).
[0060] Digest the DNA fragments of exogenous genes (such as Trypsin, EcoRI, CRIPT, ACT B, etc. but not limited to the above-mentioned genes) and DN-001 with Nco I and Xho I. After the kit is purified and recovered, use T4 DNA ligase at 16°C Ligate overnight, transform Escherichia coli DH5α, and extract the recombinant plasmid with a plasmid extraction kit. The correct DN-001 exogenous gene expression plasmid was screened out by restriction enzyme digestion and sequencing. As a control, the exogenous gene was also cloned into the pET-28a vector using Nco I and Xho I sites to construct the pET-28a exogenous gene expression plasmid.
Embodiment 3
[0061] Example 3: Induced expression of exogenous genes
[0062] The constructed recombinant plasmid was transformed into BL21(DE3), and a single clone was picked and inoculated into LB liquid medium containing ampicillin sodium (final concentration: 50 μg / ml), and cultured overnight at 37°C with shaking. On the next day, insert the overnight activated bacterial solution into fresh LB-resistant medium at a ratio of 1:200, expand the culture, and culture on a shaking table at 37°C for 3 hours. Divide the bacterial solution into two groups, one is the induction group, and the other is the induction group. One group was the control group; the induction group was added with IPTG to a final concentration of 1 mmol / L, and cultured on a shaker at 37°C for 4 hours. At the end of the induction, the induction group and the control group were centrifuged at 8500rpm for 2min, the supernatant was removed as much as possible, 1×SDS-PAGE loadingBuffer was added, boiled at 95°C for 5 minutes,...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com