Unlock instant, AI-driven research and patent intelligence for your innovation.

Construction method of Pdzd7 gene mutant animal model

A technology for animal models and construction methods, applied in the fields of botanical equipment and methods, biochemical equipment and methods, and other methods of inserting foreign genetic materials, which can solve problems such as lack of simulation and simulation

Active Publication Date: 2018-11-27
山东大学深圳研究院 +1
View PDF3 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the search found that although there are Pdzd7 gene knockout mice, there is no mouse model that simulates human-related deafness mutations and only affects long-form PDZD7. Therefore, a method for constructing a gene mutation animal model that only affects long-form PDZD7 is established. Significant

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method of Pdzd7 gene mutant animal model
  • Construction method of Pdzd7 gene mutant animal model

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0018] Embodiment 1: The construction method of Pdzd7 gene mutation animal model based on CRISPR / Cas9 technology is realized by the following steps:

[0019] (1) Selection and design of Guide RNA targeting mouse Pdzd7 gene

[0020] Design the Pdzd7 gene mutant mouse construction strategy, such as figure 1 shown.

[0021] According to the construction strategy, a suitable Guide RNA is designed at the corresponding position of the Pdzd7 gene, wherein the nucleotide sequence of Guide RNA target site1 is shown in SEQ ID NO.1, and the nucleotide sequence of Guide RNA target site2 is shown in SEQ ID NO.2 The specific sequence is as follows:

[0022] sgRNA name

sequence

PAM

Guide RNA target site1

ACAGGAGGTGGCTGGGGAGG

AGG

Guide RNA target site2

GAGGAGGTGCGCATGCGCCT

GCC

[0023] (2) In vitro synthesis of Guide RNA and Cas9 mRNA

[0024] Guide RNA and Cas9 mRNA were synthesized by Sangon Bioengineering (Shanghai) Co., Ltd.

[0025...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a construction method of a Pdzd7 gene mutant animal model based on a CRISPR / Cas9 technology. The construction method comprises the following steps: (1) designing and selectingproper Guide RNA of a targeted mouse Pdzd7 gene; (2) synthesizing Cas9 mRNA and Guide RNA in vitro; (3) preparing an injection sample jointly from Guide RNA and Cas9 mRNA in an equal molar ratio to inject an oosperm; (4) identifying the obtained F0 generation mouse; and (5) passaging the positive F0 generation mouse and obtaining and identifying F1 generation mouse. The method can be used for obtaining a Pdzd7 gene mutant mouse model close to p.C732LfxX18 pathogenic mutation in human kind successfully, thereby providing a basis for researching related factors of pathogenic mutation of PDZD7 inhuman kin and diagnoses and treatment.

Description

technical field [0001] The invention belongs to the technical field of making gene mutation animal models by using gene modification technology, and in particular relates to a method for constructing a Pdzd7 gene mutation animal model based on CRISPR / Cas9 technology. Background technique [0002] CRISPR / Cas (Clustered Regularly Interspaced Shot Palindromic repeats / CRISPR-associated) system is an acquired immune system in prokaryotes that resists foreign gene invasion. In bacteria and archaea, the CRISPR system integrates phage or plasmid DNA that invades the host CRISPR fragments to the CRISPR site, and then guide the Cas endonuclease to cut the exogenous DNA sequence through the corresponding CRISPR RNAs (cr RNAs), thereby resisting the invasion of viruses or phages. The CRISPR / Cas system is divided into three types (TypeⅠ, TypeⅡ, and TypeⅢ), among which the TypeⅡ system has been widely used since it successfully realized gene editing in mammalian cells in 2013 due to its s...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/90C12N15/12A01K67/027
CPCA01K67/0276A01K2217/075A01K2227/105A01K2267/03C07K14/47C12N9/22C12N15/907
Inventor 徐志刚杜海波王燕飞
Owner 山东大学深圳研究院
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More