Human TGFBI gene mutation detection kit and detection method thereof

A TGFBI, detection kit technology, applied in biochemical equipment and methods, microbial determination/inspection, etc., can solve the problems of abnormal cell adhesion and crawling function, no TGFBI deposition, epithelial erosion, etc.

Pending Publication Date: 2019-01-08
SHUWEN BIOTECH CO LTD
View PDF6 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Mutations can lead to abnormal cell adhesion and crawling functions, which in turn affect cell proliferation and differentiation. Under the accumulation of denatured products, it will l

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Human TGFBI gene mutation detection kit and detection method thereof
  • Human TGFBI gene mutation detection kit and detection method thereof
  • Human TGFBI gene mutation detection kit and detection method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0118] Embodiment 1 A kind of corneal abnormality mutation gene detection kit

[0119] Design specific primers and specific probes according to the target gene sequence, and the designed primers and probes can be artificially synthesized according to existing methods. Specific primers and probes are as follows:

[0120] Primer 1 (TGFBI 124-Fo): 5'TCGTTGGATCCACCACCACT3'

[0121] Primer 2 (TGFBI 124-Re): 5'GGGCGAAGATGGTGAAGCT 3'

[0122] Primer 3 (TGFBI 555-Fo): 5'CCACAAATGAAGCCTTCCGA3'

[0123] Primer 4 (TGFBI 555-Re): 5'AATGGAGACGTGTACTTAAGTTGGTC 3'

[0124] Primer 5 (GUSB-Fo): 5'GATGTTCACTGAAGAGTACCAGAAA3'

[0125] Primer 6 (GUSB-Re): 5'CCACGTATTTTCTGCGTTTTTG3'

[0126] Probe 1 (TGFBI 370T-Pr): FAM-CtgtacacggacTGcacggagaagCTG-BHQ1

[0127] Probe 2 (TGFBI 124WT-Pr): HEX-tgtacacggaccGcacggagaagC-BHQ1

[0128] Probe 3 (TGFBI 371T-Pr): TAMRA-CtgtacacggacCTcacggagaagCTG-BHQ1

[0129] Probe 4 (TGFBI 371A-Pr): FAM-CtgtacacggaccAcacggagaagCTG-BHQ1

[0130] Probe 5 (TGFBI 166...

Embodiment 2

[0141] Using the kit of Example 1 of the present invention to detect mutations at sites 124 and 555 of the human TGFBI gene comprises the following steps:

[0142] (1) Processing of samples to be tested and extraction of templates;

[0143] Twenty buccal swab samples were randomly collected, DNA was extracted with an extraction kit, and the extracted DNA stock solution was used as a template for PCR detection.

[0144] The homozygous wild, heterozygous mutant and homozygous mutant quality controls were prepared with synthetic recombinant plasmids for PCR detection. The preparation method is as follows:

[0145] TGFBI 370C / C homozygous wild quality control product: Dilute the synthesized TGFBI 370C / C plasmid and GUSB plasmid to 400 copies / μL respectively, mix the two plasmids in equal volumes, and mix well.

[0146] TGFBI 370C / T heterozygous mutation quality control product: Dilute the synthesized TGFBI 370C / C plasmid, TGFBI 370T / T plasmid and GUSB plasmid to 600 copies / μL re...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a human TGFBI gene mutation detection kit and a detection method thereof. The invention provides effective and targeted protection at an early stage for carriers of a corneal abnormality mutation gene, and can delay the development of a disease course and even avoid the onset of a disease. The invention provides a primer and a probe for detecting corneal dystrophy caused bymutation of a human TGFBI gene at a 124-site and a 555-site, and the primer and the probe are capable of detecting the mutation of the TGFBI gene at the 124-site and the 555-site, high in sensitivityand strong in specificity. The invention provides the corneal abnormality mutation gene detection kit which is capable of rapidly, efficiently and accurately detecting the mutation of the human TGFBIgene at the 124-site and the 555-site. The invention further provides the detection method for detecting the mutation of the human TGFBI gene at the 124-site and the 555-site by the kit, and the detection method has the advantages of simple operation, high sensitivity, high specificity, wide application models, true and reliable detection results, easy promotion and the like.

Description

technical field [0001] The invention belongs to the field of gene detection, and in particular relates to a human TGFBI gene mutation detection kit and a detection method thereof. Background technique [0002] Corneal dystrophies (Corneal Dystrophies, CD), also known as corneal dystrophy, is a general term for symmetrical, non-inflammatory corneal diseases. The incidence rate is about 1 / 2000, and the male to female ratio is 1.7:1.0. Most of the patients are sporadic, and about 6%-10% of the patients have a clear positive family history, and the mode of inheritance includes recessive and dominant forms. Its onset is due to the progressive damage to the structure or function of the cells in the normal corneal tissue under the action of genetic abnormalities, resulting in the formation of deposits of various shapes in the corneal tissue, which gradually reduces vision, and causes erosion and photophobia. and other complications; the cornea of ​​advanced patients will be cover...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/6858
CPCC12Q1/6858C12Q2563/107C12Q2537/143C12Q2531/113C12Q2545/113
Inventor 杨欢欢李兴民
Owner SHUWEN BIOTECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap