Human TGFBI gene mutation detection kit and detection method thereof
A TGFBI, detection kit technology, applied in biochemical equipment and methods, microbial determination/inspection, etc., can solve the problems of abnormal cell adhesion and crawling function, no TGFBI deposition, epithelial erosion, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0118] Embodiment 1 A kind of corneal abnormality mutation gene detection kit
[0119] Design specific primers and specific probes according to the target gene sequence, and the designed primers and probes can be artificially synthesized according to existing methods. Specific primers and probes are as follows:
[0120] Primer 1 (TGFBI 124-Fo): 5'TCGTTGGATCCACCACCACT3'
[0121] Primer 2 (TGFBI 124-Re): 5'GGGCGAAGATGGTGAAGCT 3'
[0122] Primer 3 (TGFBI 555-Fo): 5'CCACAAATGAAGCCTTCCGA3'
[0123] Primer 4 (TGFBI 555-Re): 5'AATGGAGACGTGTACTTAAGTTGGTC 3'
[0124] Primer 5 (GUSB-Fo): 5'GATGTTCACTGAAGAGTACCAGAAA3'
[0125] Primer 6 (GUSB-Re): 5'CCACGTATTTTCTGCGTTTTTG3'
[0126] Probe 1 (TGFBI 370T-Pr): FAM-CtgtacacggacTGcacggagaagCTG-BHQ1
[0127] Probe 2 (TGFBI 124WT-Pr): HEX-tgtacacggaccGcacggagaagC-BHQ1
[0128] Probe 3 (TGFBI 371T-Pr): TAMRA-CtgtacacggacCTcacggagaagCTG-BHQ1
[0129] Probe 4 (TGFBI 371A-Pr): FAM-CtgtacacggaccAcacggagaagCTG-BHQ1
[0130] Probe 5 (TGFBI 166...
Embodiment 2
[0141] Using the kit of Example 1 of the present invention to detect mutations at sites 124 and 555 of the human TGFBI gene comprises the following steps:
[0142] (1) Processing of samples to be tested and extraction of templates;
[0143] Twenty buccal swab samples were randomly collected, DNA was extracted with an extraction kit, and the extracted DNA stock solution was used as a template for PCR detection.
[0144] The homozygous wild, heterozygous mutant and homozygous mutant quality controls were prepared with synthetic recombinant plasmids for PCR detection. The preparation method is as follows:
[0145] TGFBI 370C / C homozygous wild quality control product: Dilute the synthesized TGFBI 370C / C plasmid and GUSB plasmid to 400 copies / μL respectively, mix the two plasmids in equal volumes, and mix well.
[0146] TGFBI 370C / T heterozygous mutation quality control product: Dilute the synthesized TGFBI 370C / C plasmid, TGFBI 370T / T plasmid and GUSB plasmid to 600 copies / μL re...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap