Promoter and its use
A promoter and Plasmodium technology, applied in the field of genetic engineering, can solve the problems that Plasmodium berghei gene editing and multi-gene expression cannot be met, and there are few promoters in Plasmodium berghei
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0055] Example 1 Validation of NT1 promoters of different lengths
[0056] Using the http: / / www.fruitfly.org / seq_tools / promoter.html website to analyze the sequence of the 2271bp upstream of the Plasmodium berghei NT1 gene, it is predicted that there are a large number of transcription start sites in the 2000bp upstream of the NT1 gene, of which 1427-1757bp The predicted transcription start site is the densest, and the 2000bp sequence around the upstream of the NT1 gene is truncated at different lengths and positions, and the transcription efficiency is compared with the commonly used Plasmodium berghei promoter pbeef1aa. The constructed vector is as follows Figure 1-2 As shown, truncated NT1 promoters of different lengths were replaced by EcoRV and BamHI restriction sites on the pl0017 vector, including NT1-1, NT1-2, NT1-3, NT1-4, NT1-5, NT1- 6. NT1-7, NT1-8 and NT1-9, the specific primers for amplifying these promoters are shown in Table 1:
[0057] Table 1
[0058]
...
Embodiment 2
[0062] Example 2 Different NT1 promoters compared with the control pbeef1aa promoter to express GFP fluorescence effect
[0063] Using the pl0018 vector as the backbone, the control promoter pbeef1aa and the comparative NT1 promoters NT1-1, NT1-6 and NT1-9 were respectively connected to the GFPm3-EAAAK3-NanoLuc-V5 fragment, and finally inserted into the backbone to form a complete vector, the terminator sequence is the original sequence on the backbone of pl0018, and the schematic diagram of constructing the vector is as follows Figure 7 As shown, the nucleotide sequence of the specific GFPm3-EAAAK3-NanoLuc-V5 fragment is shown in SEQ ID NO.28, specifically as follows:
[0064] ggatccatgagtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatattt...
Embodiment 3
[0070] Example 3 The Effect of Copy Number on the Expression of Plasmodium Exogenous Genes
[0071] Since the fluorescence intensity is not only affected by the transcription efficiency of the promoter, but also affected by the copy number of the exogenous gene in Plasmodium, this example identifies the copy number of these strains, uses GAPDH as the internal reference, and specifically obtains the primers of the GAPDH standard As shown in SEQ ID NO.38-39, the primers for obtaining GFPm3 standard products are shown in SEQ ID NO.40-41, and the specific sequences are shown in Table 3:
[0072] table 3
[0073]
[0074] The specific steps are as follows:
[0075] ①Standard product preparation
[0076] Preparation of GFPm3 standard: First, absorb 1.3 μl of GFPm3 original concentration template and add it to 98.7 μl of deionized water to form a standard with an initial concentration of 5 ng / μl, and then gradually dilute to obtain a concentration of 5.0, 5.0×10 -1 , 5.0×10 -2...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More