Nucleic acid of KANSL1 code gene mutant and application thereof
A nucleic acid, coding technology, applied in the field of genetic engineering, which can solve the problem of unclear relationship between specific signs and symptoms
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0052] Example 1 Determination of Koolen-de Vries Syndrome Causative Mutations
[0053] 1. Sample source
[0054] A 15-year-old female patient (proband) with mild mental retardation and epilepsy from Fujian Province, China, her parents had normal intelligence and no history of epilepsy. The inventor selected the patient and her parents for molecular diagnosis of epilepsy. The proband had mild mental retardation, special facial features (high and wide forehead, drooping eyelids, narrow eye clefts, upward slanted outer corners, epicanthus, bulbous nose, protruding ears), friendly personality, good at communication, However, he was emotionally unstable, irritable, and had attention deficit disorder such as trance; he had a history of epilepsy for many years, and EEG epileptiform changes. The body developed normally, and there were no obvious abnormalities in the heart, kidneys, and bones. The patient's family tree is figure 1 As shown, the arrow points to the proband, the soli...
Embodiment 2
[0067] Example 2 Sanger method sequencing verification
[0068] Detect the KANSL1 gene of the family members (including 1 patient and 2 normal family members) in the Koolen-de Vries syndrome patient family described in Example 1: c.3031C>T mutation design for the KANSL1 gene primers, and then obtain the relevant sequence of the mutation site by PCR amplification, product purification and sequencing, and verify whether the c. correlation between.
[0069] The specific method steps are as follows:
[0070] 1. DNA extraction
[0071] Refer to the method for extracting DNA described in Example 1.
[0072] 2. Primer design and PCR reaction
[0073] First, referring to the human genome sequence database hg19 / build36.3, an exon-specific primer targeting the c.3031C>T mutation of the KANSL1 gene was designed. The specific sequence is as follows:
[0074] Upstream primer F: TGTTGGTGTTTGTTTGCCTC (SEQ ID NO: 3)
[0075] Downstream primer R: CAACTGTATTGATCATTTAG (SEQ ID NO: 4)
[0...
Embodiment 3
[0080] Embodiment 3 KANSL1 gene mutant detection kit
[0081] The KANSL1 gene mutant detection kit includes primers capable of detecting the c.3031C>T mutation of the KANSL1 gene. These primers are specific primers for the KANSL1 gene, and their sequences are shown in SEQ ID NO: 3-4 in Example 2. This kit can be used to screen biological samples susceptible to Koolen-de Vries syndrome.
[0082] The specific steps of utilizing the above-mentioned kit to screen biological samples susceptible to Koolen-de Vries syndrome include: extracting the DNA of the subject to be tested, according to the method described in step 2 of Example 1; using the extracted DNA as a template and the above-mentioned KANSL1 Perform PCR reaction with gene-specific primers, and purify the PCR product according to conventional methods in the field; sequence the purified product; compare the sequence obtained by sequencing with the sequence of SEQ ID NO: 1 to determine whether there is c.3031C> T mutation...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More