Method and kit for detecting ubiquitin protease gene PSMB1 promoter polymorphism
A kit and protease technology, applied in biochemical equipment and methods, microbial determination/inspection, etc., can solve problems such as changes in the number and properties of antigenic peptides
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0052] Embodiment 1, acquisition and identification of SNP
[0053] 1. Research object
[0054] Human peripheral blood samples were collected on the basis of informed consent.
[0055] 2. Experimental methods and results
[0056] 1. DNA extraction
[0057] DNA was extracted from human peripheral blood samples by the conventional phenol-chloroform method (commercial kits can also be used to extract DNA), and the concentration was corrected to 20ng / μl for conventional PCR amplification.
[0058] 2. Primer design for PCR and sequencing
[0059] According to the genome sequence of PSMB1 in GenBank, the following primers were designed and synthesized:
[0060] Sense primer P1: tgcatctgcttttcaatgct (SEQ ID NO: 3);
[0061] Antisense primer P2: GCCTGtgtatgagtggctga (SEQ ID NO: 4).
[0062] 3. PCR amplification of PSMB1 gene
[0063] Using the extracted DNA as a template, PCR amplification was carried out on a GeneAmp 9700 PCR instrument with the Touchdown program using Taq enz...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
