Supercharge Your Innovation With Domain-Expert AI Agents!

Method and kit for detecting ubiquitin protease gene PSMB1 promoter polymorphism

A kit and protease technology, applied in biochemical equipment and methods, microbial determination/inspection, etc., can solve problems such as changes in the number and properties of antigenic peptides

Inactive Publication Date: 2019-03-22
SHANGHAI IND TECH INST +1
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Moreover, the promoter polymorphism of the PSMB1 gene affects the expression of the gene, causing changes in the quantity and nature of the antigenic peptides produced by degrading endogenous proteins

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method and kit for detecting ubiquitin protease gene PSMB1 promoter polymorphism

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] Embodiment 1, acquisition and identification of SNP

[0053] 1. Research object

[0054] Human peripheral blood samples were collected on the basis of informed consent.

[0055] 2. Experimental methods and results

[0056] 1. DNA extraction

[0057] DNA was extracted from human peripheral blood samples by the conventional phenol-chloroform method (commercial kits can also be used to extract DNA), and the concentration was corrected to 20ng / μl for conventional PCR amplification.

[0058] 2. Primer design for PCR and sequencing

[0059] According to the genome sequence of PSMB1 in GenBank, the following primers were designed and synthesized:

[0060] Sense primer P1: tgcatctgcttttcaatgct (SEQ ID NO: 3);

[0061] Antisense primer P2: GCCTGtgtatgagtggctga (SEQ ID NO: 4).

[0062] 3. PCR amplification of PSMB1 gene

[0063] Using the extracted DNA as a template, PCR amplification was carried out on a GeneAmp 9700 PCR instrument with the Touchdown program using Taq enz...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method and a kit for detecting ubiquitin protease gene PSMB1 promoter polymorphism. The detection method comprises the following steps: detecting a sequence of an individualPSMB1 gene promoter region and comparing the sequence with a sequence of a normal PSMB1 gene promoter region, if difference exists, the individual has specific promoter polymorphism of a PSMB1 gene. The kit comprises a specific amplification PSMB1 gene primer, the primer can amplify out an amplification product, the length of the amplification product is 100 to 2000 bp, and the amplification product contains the 321st site in the SEQ ID NO.1. The method and the kit disclosed by the invention can be applied to detecting the gene type situation of ubiquitin protease gene PSMB1 promoter polymorphism rs12527072.

Description

technical field [0001] The invention belongs to the field of biotechnology, and more specifically, the invention relates to a method and a kit for detecting the polymorphism of the ubiquitin protease gene PSMB1 promoter. Background technique [0002] The PSMB1 gene is located at 6q27, with a size of about 22Kbp. The product encoded by it belongs to the proteasome type B family and is a 20S core β-subunit in the ubiquitin-protease complex. Proteasome is a proteolytic enzyme complex that exists in the cytoplasm and nucleus, responsible for degrading most of the proteins in the cell, and plays a key role in the expression of MHC class I molecules including HLA-B27 molecules and the presentation of related antigens. The antigens presented by MHC class I molecules are all derived from the degradation products of proteasome. The function of proteasome is regulated by its structural composition, and its core part is a four-ring cylindrical structure composed of α and β subunits, w...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6883
CPCC12Q1/6883C12Q2600/156
Inventor 黄薇牛振民施锦绣张晨辉
Owner SHANGHAI IND TECH INST
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More