Method for detecting blood microsatellite instability based on second generation sequencing technology

A technology of microsatellite instability and next-generation sequencing technology, applied in sequence analysis, instruments, hybridization, etc., can solve the problem of blood samples not being very good, and achieve high consistency results

Inactive Publication Date: 2019-04-05
GENEIS TECH BEIJING CO LTD
View PDF10 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the effect is obvious, the detection is based on tissue, and the results are not very good for blood samples; for clinical gold standard detection such as MSI-PCR technology, it is also only suitable for MSI detection on tissue samples. For blood sample detection MSI is completely indistinguishable

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting blood microsatellite instability based on second generation sequencing technology

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] Select 10 cases of corresponding plasma and white blood cell samples known to have passed the 3730 Yuewei kit (patent number: ZL 2011 1 0152226.X) to verify the results of MSI (3 cases of MSI-H high-frequency unstable type, 7 cases of MSS stable type ) of the next-generation amplicon sequencing data, the following detection methods were performed.

[0051] The specific detection method is illustrated by taking an example sample1 of a high-frequency unstable MSI-H as an example.

[0052] 1. Determine the 5 biomarkers of the microsatellite loci used in the data, namely BAT25, BAT26, MONO27, NR21 and NR24, and determine the corresponding amplification primer sequences for the 5 markers, as follows:

[0053] BAT25 primers:

[0054] Primer 1: TCTGCATTTTAACTATGGCTC (SEQ ID NO: 1)

[0055] Primer 2: CTCGCCTCCAAGAATGTAAGT (SEQ ID NO: 2)

[0056] BAT26 primer:

[0057] Primer 1: CTGCGGTAATCAAGTTTTTAG (SEQ ID NO: 3)

[0058] Primer 2: AACCATTCAACATTTTTTAACCC (SEQ ID NO: 4) ...

Embodiment 2-10

[0079] Examples 2-10 were selected from the corresponding plasma and white blood cell samples (3 cases of MSI-H high-frequency non Stable type, the second-generation amplicon sequencing data of 7 cases of MSS stable type) were used as objects, and the above steps 1-10 were repeated. The results are shown in Table 1.

[0080] Table 1

[0081] Sample ID

[0082] Note: MSI-PCR verification results and prediction results statistics, where "+" means unstable, "-" means stable.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for detecting blood microsatellite instability based on a second-generation sequencing technology, which comprises the following steps: respectively determining the length and the number of each sequence corresponding to the same microsatellite locus to be detected in second-generation sequencing data of plasma DNA and blood leukocyte DNA, determining the length ofthe sequencing sequence with difference by comparison. Determining the sequence length L corresponding to the primer and / or the probe and the length L'of the corresponding microsatellite locus to bedetected in the known genome, and if the number of sequences with different sequencing sequence lengths is more than 2 in the judgment range window of L-L'(X (L+L'), and accounts for more than 50% ofthe total sequence length in the judgment range window, the microsatellite locus is judged to be unstable, and conversely, the microsatellite locus is judged to be stable. Repeating the process to judge the stability of a plurality of microsatellite loci so as to detect the microsatellite instability of the sample. The method for detecting blood microsatellite instability based on second generation sequencing technology can complete the detection only by extracting the blood of the patient without depending on tumor tissues.

Description

technical field [0001] The invention generally relates to the field of gene detection, in particular to a method for detecting blood microsatellite instability (MSI) based on next-generation sequencing technology. Background technique [0002] In prokaryotic and eukaryotic genomes, there are many short tandem repeat DNA sequences (1-6 bases) widely distributed, namely microsatellite sequences (MicroSatellite, MS). In the process of DNA replication, small-scale base deletions, insertions or substitutions often occur in these sequences, showing instability, which is called Microsatellite Instability (MSI). The MSI phenomenon was first discovered in colorectal cancer by Jacobs et al. in 1993. Because it is related to the occurrence of cancer, it can be used for cancer detection (William R. Jacobs, et al, Science, 1993, 260:816-818). In 2016, Ronald J Hause et al. analyzed 5930 genomes of 18 cancers using genome-wide exome sequencing technology, and found that MSI occurred in ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): G16B25/00G16B30/00G16B40/00
Inventor郎继东田埂
OwnerGENEIS TECH BEIJING CO LTD